ID: 1062934519

View in Genome Browser
Species Human (GRCh38)
Location 10:1375885-1375907
Sequence GTATGTGCACGTGTGTGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1063
Summary {0: 1, 1: 4, 2: 21, 3: 137, 4: 900}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062934519 Original CRISPR GTATGTGCACGTGTGTGGTG TGG (reversed) Intronic
900137404 1:1123861-1123883 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900137428 1:1124138-1124160 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900295253 1:1945861-1945883 GTGTGTGCACGTGTGTGTGTGGG + Intronic
900295258 1:1945927-1945949 ATGTGTGCACGTGTGTGTGGGGG + Intronic
900392021 1:2437834-2437856 GTGTGTGCACGTGTGTGGTTTGG - Intronic
900430710 1:2601850-2601872 GTTTCTGCACCTGTGTAGTGGGG - Intronic
900563724 1:3322217-3322239 GCATGTGCACGTGTGTGTGTGGG + Intronic
900581096 1:3409881-3409903 TTGTGTGCATGTGTGTGGTGTGG + Intronic
900581101 1:3409923-3409945 GTATGTGCATGTGTGTGGTGTGG + Intronic
901022809 1:6263539-6263561 CTGTGAGCACGTGTGTGGTGAGG - Intergenic
901163364 1:7197623-7197645 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
901297790 1:8173903-8173925 GTATGTGCACGTATGTGTGCAGG - Intergenic
902392477 1:16114677-16114699 GCATGTGCATGTATGTAGTGGGG + Intergenic
902538333 1:17134762-17134784 GTGTGTGCACAGGTGTTGTGTGG - Intergenic
902709948 1:18231945-18231967 GTGTGTGTGTGTGTGTGGTGAGG + Intronic
902718484 1:18289046-18289068 GTGTGTGGATGTGTGGGGTGTGG + Intronic
902988231 1:20168767-20168789 GTATGTGCATGTGGGCGGAGGGG + Intronic
903210457 1:21815127-21815149 GTGTGTGAATGTGTGTGGGGAGG - Intronic
903634746 1:24804372-24804394 GTGTGTGCATGTGTGTGGGTGGG + Intronic
903774063 1:25781697-25781719 GAATGGGCACGGGGGTGGTGGGG - Intronic
904976945 1:34463940-34463962 GTATGTGTATTTGTGTGGAGAGG - Intergenic
905233669 1:36530745-36530767 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
905488952 1:38328654-38328676 GCAGGTGCACGTGCATGGTGGGG - Intergenic
905640424 1:39585828-39585850 GTGTGTGCATGTGTCTAGTGAGG + Intergenic
905874729 1:41424844-41424866 GTATGTGTGGGTGTGTGGTGTGG + Intergenic
906733143 1:48100447-48100469 GTGTGTGCATGTGTGTAGTGGGG + Intergenic
906875715 1:49536376-49536398 TCATGTGCATGTGTGTGTTGGGG + Intronic
907663478 1:56414559-56414581 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
907788508 1:57637465-57637487 GTATATGCAGGTGTGTGTAGGGG + Intronic
908696310 1:66845840-66845862 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
909318311 1:74251665-74251687 GTGTGTGCACGTGTGGGAGGAGG + Intronic
909348516 1:74621176-74621198 TTAAGTGCAAGTGTGTGGGGAGG + Intronic
909472270 1:76041667-76041689 GGATGTACACGTGAGAGGTGAGG + Intergenic
910227105 1:84947301-84947323 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
910729397 1:90376270-90376292 GTATGTGTGTGTATGTGGTGTGG - Intergenic
911061712 1:93753846-93753868 GTACGTGTACATGTGTGTTGGGG - Intronic
911315764 1:96354855-96354877 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
912296960 1:108478993-108479015 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
912449227 1:109759167-109759189 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
914240989 1:145852976-145852998 GTATGTGCATGTGTGTGGAGGGG - Intronic
914973158 1:152329952-152329974 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
915044922 1:153004248-153004270 GTGTGTGTATGTGTGTGGTGGGG - Intergenic
915589779 1:156864260-156864282 GCATGTGCATGTGTATTGTGAGG + Intronic
915609790 1:156982520-156982542 CTGTGTGCATGTGTGTGTTGGGG - Intronic
916499071 1:165370835-165370857 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
916619329 1:166478774-166478796 GGATATGCATGTGTGTGGCGGGG + Intergenic
916720113 1:167478471-167478493 GTATGTGTGTGTGTTTGGTGGGG + Intronic
916945493 1:169722147-169722169 GTGTGTGCGTGTGTGTGTTGGGG + Intronic
917081564 1:171261306-171261328 GTGTGTGCCTGTGTGTGTTGGGG - Intronic
917232957 1:172857608-172857630 GTATGTGTATCTGTGTGTTGGGG - Intergenic
917250816 1:173058672-173058694 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
917392350 1:174552216-174552238 GTAGGTAAACTTGTGTGGTGGGG + Intronic
917442524 1:175079968-175079990 GTGTGTGTGTGTGTGTGGTGAGG + Intronic
918422884 1:184381942-184381964 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
919193531 1:194253920-194253942 GTGTGTGTATGTGTGTGGTGAGG - Intergenic
919423465 1:197400973-197400995 GTATATGTATGTGTGTGTTGGGG - Intronic
919924228 1:202184176-202184198 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
920402232 1:205683159-205683181 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
920668118 1:207981525-207981547 GTGTGTGCATGTGTGTGTAGAGG + Intergenic
920673258 1:208020914-208020936 GTGTGTACATGTGTGCGGTGTGG + Intergenic
921348773 1:214214166-214214188 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
921373715 1:214451684-214451706 GTGGGTGCGGGTGTGTGGTGGGG - Intronic
921384589 1:214555717-214555739 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
922085615 1:222344216-222344238 GTATGTGTACGTGTGTGTGATGG + Intergenic
922746406 1:228046746-228046768 ATGTGTGCTTGTGTGTGGTGGGG + Intronic
923377949 1:233384711-233384733 GTGTTTGCATGTGTGTGTTGGGG + Exonic
923621982 1:235587136-235587158 GTGTGTGAAAGTGTGGGGTGGGG + Intronic
923869088 1:237971558-237971580 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
924490192 1:244528780-244528802 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
924662162 1:246030937-246030959 GCATGTGGACGTGTTTAGTGGGG + Intronic
924933961 1:248752471-248752493 TGATGTGCATGTGTGTGGTGAGG - Intronic
1062794861 10:337095-337117 GTGTGTGCGTGTGTGTGTTGTGG + Intronic
1062794875 10:337204-337226 GTGTGTGCAAGTGTGTGTGGTGG + Intronic
1062794894 10:337344-337366 GTGTGCGCGCGTGTGTGTTGTGG + Intronic
1062794927 10:337659-337681 GTGTGTACGCGTGTGTGTTGTGG + Intronic
1062887090 10:1025005-1025027 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1062934519 10:1375885-1375907 GTATGTGCACGTGTGTGGTGTGG - Intronic
1063039244 10:2319986-2320008 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1063463060 10:6226502-6226524 GTCTGTGCACGTGTGTTGTGGGG + Intronic
1064283424 10:13971061-13971083 GTGTGTGCACCTGTGTGTTGGGG - Intronic
1064608089 10:17065137-17065159 GTCTGTGCATGTGTGTGTGGGGG - Intronic
1064906158 10:20348037-20348059 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1065052450 10:21809944-21809966 GTGTGTGTATGTGTGTGGCGGGG + Intronic
1065286145 10:24189474-24189496 GTGTGTGCACATGTGTGTTTGGG - Intronic
1067390705 10:45860505-45860527 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1067419630 10:46134548-46134570 CTATGTGCATGTGTGGGGAGCGG + Intergenic
1067426388 10:46214863-46214885 CTATGTGCATGTGTGGGGAGTGG - Intergenic
1067438159 10:46293234-46293256 GTGTATGCATGTGTGTGGGGGGG + Intronic
1067504982 10:46841145-46841167 CTATGTGCATGTGTGGGGAGCGG + Intergenic
1067682968 10:48451764-48451786 GTATGTGCGATTGTGTGTTGGGG - Intronic
1068243322 10:54334314-54334336 GAATGTGAATGTGTGTGGCGTGG - Intronic
1068461721 10:57337764-57337786 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1068603869 10:58984018-58984040 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1069108688 10:64415807-64415829 GGATATGCATGTGTGTTGTGGGG + Intergenic
1069289709 10:66763043-66763065 GTATGTGCATGTCTGTGGGGTGG + Intronic
1069304075 10:66946760-66946782 GTGTGTGCCTGGGTGTGGTGGGG - Intronic
1069580456 10:69562712-69562734 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1069906440 10:71735198-71735220 GTTGGTGCAAGTGTGTGGGGTGG + Intronic
1070137892 10:73710740-73710762 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1070647486 10:78211810-78211832 GTGTGTGTACGTGTGTGATGAGG + Intergenic
1070823633 10:79378262-79378284 GAGGGTGCACGTGTGCGGTGTGG + Intergenic
1071318999 10:84433420-84433442 GTGTGTGTATGTGTGTGGGGTGG - Intronic
1071526874 10:86364294-86364316 CTGTGTGCACGTGTGCGCTGAGG - Intronic
1071793357 10:88979846-88979868 GTGTGAGGAGGTGTGTGGTGAGG - Intronic
1071956130 10:90761648-90761670 GTGTGTGTGTGTGTGTGGTGAGG + Intronic
1072107625 10:92289910-92289932 GTGTGTGTATGTGTGTGGTGGGG + Intronic
1072152250 10:92692243-92692265 GTATGTGAATGTGTCTGGTTGGG + Intronic
1072422554 10:95301373-95301395 GTATGTGAGTGTGTGTGTTGAGG + Intergenic
1072758457 10:98036582-98036604 GTGTGTGCATGTGTGAGGAGGGG + Intergenic
1072775179 10:98184059-98184081 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1073207606 10:101776849-101776871 GTGTGTGTGTGTGTGTGGTGAGG - Intronic
1073488413 10:103836639-103836661 GTGTGTGCACTCGTGTGTTGGGG - Intronic
1074267587 10:111920225-111920247 GTGTGTGCATGTGTGTGGATGGG - Intergenic
1074707501 10:116148112-116148134 GTGTGTGCATGTGTGTGGGGTGG + Intronic
1075649991 10:124121515-124121537 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1075785758 10:125049098-125049120 GTGTGTGTATGTGTGTGGTCAGG - Intronic
1075953442 10:126502045-126502067 GTGTGTGCGTGTGTGTGGTGTGG - Intronic
1076042450 10:127262278-127262300 GTGTGTGTACCTGTGTGCTGAGG + Intronic
1076189342 10:128472097-128472119 GTATGTGGGTGTGTGTGGGGGGG - Intergenic
1076422027 10:130338589-130338611 GTATGTGCGTGTGTGTGTGGGGG + Intergenic
1076546338 10:131247978-131248000 GTATGTGCACCTGAGTCATGTGG - Intronic
1076802542 10:132837282-132837304 GTATGTCTCCATGTGTGGTGTGG - Intronic
1076874497 10:133209198-133209220 GCGTGTACACGTGTGTGGTTGGG + Intronic
1076874513 10:133209352-133209374 GTGTGTGCACATGTGGTGTGAGG + Intronic
1076903073 10:133349474-133349496 GTCTGTGCATGTGTGTTTTGTGG - Intronic
1077020514 11:415305-415327 GTGTGTGTGCGTGTGTGTTGTGG + Intronic
1077020516 11:415307-415329 GTGTGTGCGTGTGTGTTGTGGGG + Intronic
1077374180 11:2197866-2197888 GTGTGTGCATGTGTGGTGTGTGG - Intergenic
1077477909 11:2799386-2799408 GTGTGTGTGTGTGTGTGGTGTGG + Intronic
1077489549 11:2854353-2854375 GTATGTGTAGGTGTGTGTAGGGG - Intergenic
1077721854 11:4637809-4637831 GTATGTGCACGTGTGTGTTGTGG + Intergenic
1078011764 11:7577713-7577735 GTGTGTGCCTGTGTGTGGTAGGG + Intronic
1078918586 11:15804947-15804969 GTATGTGCATGTGTGTGTTGGGG - Intergenic
1079133636 11:17763723-17763745 GTATATGAACATGTGTGGGGAGG - Intronic
1079133671 11:17763906-17763928 ATATGTGCATGTGTGGTGTGTGG - Intronic
1079920197 11:26424248-26424270 GTATGTGTGTGTGTGTGGGGGGG - Intronic
1080709348 11:34731862-34731884 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1080813801 11:35733801-35733823 GGATGTGCACATGTGTGTTTTGG - Intronic
1081087750 11:38822436-38822458 GTATGTGCATGTGTGTGGTCAGG - Intergenic
1081677262 11:44977665-44977687 GTGTGTGCATGTGTGTGATCTGG - Intergenic
1081707259 11:45190118-45190140 GTGTGTGCACGTGTGTGTGTAGG - Intronic
1083190115 11:61045253-61045275 GTATTTGTATGTGTGTAGTGGGG - Intergenic
1084215408 11:67644727-67644749 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1084523480 11:69680903-69680925 GTGTGTGCATGTGTGTGGGTCGG - Intergenic
1085761026 11:79241726-79241748 GTGTGTGCATGTGTATGGTGGGG + Intronic
1085926178 11:81024662-81024684 TTGTGTGCATGCGTGTGGTGGGG + Intergenic
1086158985 11:83699924-83699946 GTGTGTGTGCATGTGTGGTGGGG - Intronic
1086189977 11:84067551-84067573 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1086551315 11:88056019-88056041 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1087161471 11:94951849-94951871 GTATGTGCATGTATGTGCAGGGG + Intergenic
1087642112 11:100766227-100766249 GTGTGTGTGTGTGTGTGGTGTGG + Intronic
1087792136 11:102417410-102417432 GTATTTGTATGTTTGTGGTGGGG - Intronic
1088021111 11:105120672-105120694 GTGTGTGTATGTGTGTGTTGGGG - Intergenic
1088200721 11:107330639-107330661 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1088566745 11:111180602-111180624 GTGCGCGCACGCGTGTGGTGGGG - Intergenic
1089281940 11:117380877-117380899 GTGTGTGCACGTGTGTGTACTGG + Intronic
1089398477 11:118151107-118151129 GTGTGTGCACGTGTGTAAGGGGG - Intronic
1089626194 11:119752457-119752479 GTCTGTGCATGTGTGCAGTGTGG - Intergenic
1089797359 11:120992289-120992311 GTATATGTGTGTGTGTGGTGTGG + Intergenic
1090399196 11:126437982-126438004 GATTGTGTACATGTGTGGTGTGG - Intronic
1090646673 11:128772023-128772045 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1090749990 11:129738062-129738084 GTATGTGCACGTTTGTGGAATGG - Intergenic
1090863490 11:130674849-130674871 GTATGTGCTCGTGTGATTTGGGG + Intronic
1090907864 11:131093216-131093238 GTGTGTGTGTGTGTGTGGTGCGG + Intergenic
1091023928 11:132125289-132125311 GTGTGTGTGTGTGTGTGGTGTGG + Intronic
1091040003 11:132268569-132268591 GTGTGTGTCTGTGTGTGGTGTGG + Intronic
1091040008 11:132268631-132268653 GTATGTGTGTGTTTGTGGTGTGG + Intronic
1091225154 11:133952522-133952544 TTGTGTGCACGTGCGTGGAGTGG - Intronic
1091332970 11:134744883-134744905 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1091486763 12:896881-896903 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1091625547 12:2118252-2118274 GTGTGTGCACGGGTCTGGTTTGG + Intronic
1091713775 12:2761535-2761557 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1091799511 12:3316087-3316109 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1091993986 12:4978527-4978549 GTGTGAGCATGTTTGTGGTGGGG + Intergenic
1092064843 12:5581402-5581424 CCATGTGCACGAATGTGGTGAGG - Intronic
1092165188 12:6338005-6338027 GTGTGTGCTTGTGTGTGGGGAGG - Intronic
1092312563 12:7374394-7374416 GTGTGTGCACGTGTGTGTAGAGG + Intronic
1092937076 12:13374092-13374114 GTGTGTGCATGTGTGTGTTGGGG + Intronic
1093519245 12:20028908-20028930 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1094005005 12:25740046-25740068 GTGTGTGCGAGTGTGTGGTGAGG - Intergenic
1094078818 12:26509988-26510010 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1094123862 12:27002039-27002061 GTGTGTGCGTGTGTGTTGTGGGG - Intronic
1094299232 12:28942830-28942852 GTGTGTGCATGTGGGGGGTGAGG + Intergenic
1094479153 12:30866845-30866867 GTGTGTGCACATGTGTGATTTGG - Intergenic
1094870900 12:34598755-34598777 GTAGAGGCACTTGTGTGGTGTGG + Intergenic
1094871974 12:34603801-34603823 GTCAGAGCACCTGTGTGGTGAGG + Intergenic
1095082698 12:38025768-38025790 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1095211813 12:39503069-39503091 GTGTGTGTATGTGTGTGGTGGGG - Intergenic
1095481552 12:42641398-42641420 GGCTGTGCATGTGTGTGCTGGGG - Intergenic
1095662865 12:44758066-44758088 GTGTGTGTATGTGTGTGGCGGGG - Intronic
1096513361 12:52143943-52143965 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1096542947 12:52318393-52318415 GTGTGTGAATGTGTGTGGTTGGG + Intronic
1097053733 12:56238307-56238329 CTGTGTGCAGGTGTGTGTTGGGG - Exonic
1097177486 12:57151809-57151831 GTATGTGCGTGTGTGTGTGGTGG + Intronic
1097287396 12:57888756-57888778 GGAAGTGCATGTGTGTGGTGCGG + Intergenic
1097493798 12:60302180-60302202 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1097636085 12:62123767-62123789 GTGTGTGTATGTGTGTGGTGGGG - Intronic
1097823388 12:64150138-64150160 GCATGTGCACGTGTGTGGGTGGG + Exonic
1097947172 12:65382843-65382865 ATATATACACGTGTGTGGTGGGG - Intronic
1098579775 12:72085617-72085639 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1098597799 12:72294354-72294376 GTCTGTGTGTGTGTGTGGTGGGG + Intronic
1099143009 12:79003301-79003323 TTGTGTGTATGTGTGTGGTGGGG - Intronic
1099198226 12:79645031-79645053 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1099653917 12:85465275-85465297 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1099775924 12:87130212-87130234 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1100936001 12:99666880-99666902 GTGTGTGTGTGTGTGTGGTGAGG + Intronic
1101576608 12:106002855-106002877 GTGTGTGTATGTGTGTGATGAGG - Intergenic
1101845984 12:108363376-108363398 ATGTGTGCATATGTGTGGTGTGG + Intergenic
1101845998 12:108363499-108363521 GCATGTGCATGTGTGTGGTATGG + Intergenic
1102044079 12:109818795-109818817 GTGTGTGCATGTGTGTTTTGGGG - Intronic
1102695847 12:114798799-114798821 GTGTGTGCACGTGTGTGTAAGGG + Intergenic
1102838612 12:116092755-116092777 GTATGGGTATATGTGTGGTGGGG + Intronic
1103219798 12:119234219-119234241 CAATGTGCAGGTGTGTAGTGAGG - Intergenic
1103306793 12:119971447-119971469 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1103427870 12:120853963-120853985 GTATGTGTGCGTGTGTGTGGTGG - Intronic
1103576758 12:121883220-121883242 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1103615500 12:122149187-122149209 GTGCGTGCACCTGTGTGGTGGGG - Intergenic
1104141107 12:125986226-125986248 GCAGGTGCAGGTTTGTGGTGGGG + Intergenic
1104191418 12:126485400-126485422 ATCTGTGCACGTCTGTGGTGCGG - Intergenic
1104557827 12:129817866-129817888 GTATGTGTGTGTGTGTGGTGTGG + Intronic
1105962217 13:25352535-25352557 GTATGTGCACATGTGTGAGGGGG + Intergenic
1106131680 13:26945526-26945548 GTTTGTGTATGTGTATGGTGTGG - Intergenic
1106132300 13:26950658-26950680 GTGTGTGCGTGTGTGTGCTGTGG - Intergenic
1106227939 13:27799053-27799075 GTATGTGTGTGTGTGTGGGGGGG - Intergenic
1106333601 13:28763052-28763074 GCATGTGCACGTGTGTGTAGGGG + Intergenic
1106408045 13:29490991-29491013 GTGTGTGTGTGTGTGTGGTGTGG + Intronic
1106421641 13:29590359-29590381 GTATGTGTGTGTGTTTGGTGGGG - Intronic
1106430851 13:29679069-29679091 GTGTGTGTATGTGTGTGGAGAGG + Intergenic
1106486070 13:30173881-30173903 GTGTGTGCACATGTGTGTGGGGG - Intergenic
1106584121 13:31042682-31042704 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1106778919 13:33036326-33036348 GTGTGTGCATGTGTTTAGTGAGG - Intronic
1106992291 13:35435533-35435555 ATATGTGCAGGAGTGGGGTGGGG + Intronic
1108363707 13:49690487-49690509 GTGCGTGCGCGTGTGTGGTGGGG + Intronic
1108458495 13:50641640-50641662 GTGTGTGTGTGTGTGTGGTGAGG + Intronic
1108537459 13:51399726-51399748 GTGTGTGCGTGTGTGTAGTGGGG + Intronic
1108659719 13:52573906-52573928 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1109595469 13:64548377-64548399 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1110012503 13:70355465-70355487 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1110427985 13:75391027-75391049 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1110980782 13:81894651-81894673 GTATGTGTGCGTGTGAAGTGTGG - Intergenic
1111423892 13:88053899-88053921 GTAAGTGAACGTGTGTCATGGGG - Intergenic
1111435507 13:88201204-88201226 GTATGTGTGAGTGTGTGTTGAGG - Intergenic
1111677149 13:91400587-91400609 GTTTGTGCGTGTGGGTGGTGAGG + Intronic
1111739819 13:92189574-92189596 GTGTGTGCACGTGTATGGAAAGG - Intronic
1112274975 13:98008649-98008671 GTATGTGCGTGTGTGTCGAGAGG - Intronic
1112439329 13:99414440-99414462 GTGTGTGCACGTGTGTGAGTGGG - Intergenic
1112565701 13:100549825-100549847 GTATGTGCTCATGTGTGTTGGGG - Intronic
1113053565 13:106241477-106241499 GGATGTGCATATGTGTAGTGGGG - Intergenic
1113225653 13:108156932-108156954 GTATGTGTGTGTGTGTGGGGGGG - Intergenic
1113266545 13:108624431-108624453 TTATGTGCACATGTGTGATATGG - Intronic
1113363574 13:109654772-109654794 GTGTGTGTGCATGTGTGGTGTGG + Intergenic
1113363581 13:109655039-109655061 GCATGTGAGCATGTGTGGTGTGG + Intergenic
1113489334 13:110679031-110679053 GTCTGTTCACATGTGTGGTAAGG - Intronic
1113598931 13:111554654-111554676 GGGTGTGAACGTGTGTGGGGAGG - Intergenic
1113613810 13:111666543-111666565 GTATGTGCATGTGTGTGCATTGG + Intronic
1113697695 13:112358310-112358332 GAATGTGCATGTGTGTTGTGGGG + Intergenic
1113870563 13:113557184-113557206 GTGTGTGCACATGTGTGTAGGGG + Intergenic
1113888248 13:113672324-113672346 GTATGTGTATGTGTGGTGTGTGG + Intronic
1113901366 13:113800154-113800176 GTATGTGTATGTGTGTGTGGAGG + Intronic
1113901608 13:113801107-113801129 GTAGGTGCAGGGGTGTGGGGGGG - Intronic
1114545101 14:23494196-23494218 GGATGCGCACATGTGGGGTGGGG - Intronic
1114724301 14:24918447-24918469 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1115413290 14:33101134-33101156 GTGTGTGCAGGTGTGTGTGGGGG - Intronic
1115749706 14:36477156-36477178 GTTTGTGCACGTGTGTCCTCAGG + Intronic
1115788712 14:36855615-36855637 GTATGAGCAACTGTGGGGTGGGG + Intronic
1115888724 14:38003711-38003733 GTATGTGTGTGTGTGTGGTGGGG + Intronic
1115938407 14:38581217-38581239 GTATGTGAACTTTTGTGGGGAGG - Intergenic
1117164844 14:53022984-53023006 GCATGAGCTTGTGTGTGGTGTGG + Intergenic
1117754130 14:58956578-58956600 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1118181037 14:63493488-63493510 GTGTGTGCGTGTGTGTGGTGGGG + Intronic
1119144812 14:72302661-72302683 GTATGTGTATGTGTGTGTTGGGG - Intronic
1119262781 14:73247518-73247540 GTATGTGTGTGTGTGTGTTGTGG + Intronic
1120653819 14:87165780-87165802 GTGTGTGTATGTGTGTGTTGGGG - Intergenic
1121563299 14:94890185-94890207 GTATGTGTATGTGTGGTGTGTGG + Intergenic
1121563331 14:94890451-94890473 GTGTGTACGTGTGTGTGGTGTGG + Intergenic
1121566562 14:94914503-94914525 GGATGGGCAGGTGTGTGGTGTGG - Intergenic
1121608374 14:95258070-95258092 GTGTGTGCTTGTGTGGGGTGTGG + Intronic
1121608396 14:95258324-95258346 GTATGTGTATGTGTGGTGTGTGG + Intronic
1121746197 14:96295722-96295744 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1122368333 14:101212351-101212373 GTGTGTGTGCGTGTGTGTTGAGG - Intergenic
1122663150 14:103311277-103311299 ATATGTGCGCCTGTGTGTTGGGG + Intergenic
1122828623 14:104384356-104384378 GAATGTGCACATGTGTGAAGGGG + Intergenic
1122868128 14:104619040-104619062 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1123040615 14:105488799-105488821 GTACATGCGCGTGTGTGCTGGGG + Intronic
1123054746 14:105563989-105564011 GTGTGTGCACGTGTGGGGTGTGG + Intergenic
1123055486 14:105567384-105567406 GTGTGGACAGGTGTGTGGTGTGG + Intergenic
1123055509 14:105567485-105567507 GTGTGGACAGGTGTGTGGTGCGG + Intergenic
1123055548 14:105567654-105567676 GTATGGACAGGTGTGTGGGGTGG + Intergenic
1123055560 14:105567703-105567725 GTGTGGACAGGTGTGTGGTGTGG + Intergenic
1123055572 14:105567753-105567775 GTGTGGACAGGTGTGTGGTGTGG + Intergenic
1123055584 14:105567803-105567825 GTGTGGACAGGTGTGTGGTGTGG + Intergenic
1123055590 14:105567837-105567859 GTGTGGACAGGTGTGTGGTGTGG + Intergenic
1123055596 14:105567854-105567876 GTGTGGGCAGGTGTGTGGGGTGG + Intergenic
1123079153 14:105683395-105683417 GTGTGTGGATGTGTGGGGTGTGG + Intergenic
1123079186 14:105683548-105683570 GTGTGTGCACGTGTGGGGTGTGG + Intergenic
1123707951 15:22964269-22964291 GTGTGTGTGTGTGTGTGGTGAGG - Intronic
1124024906 15:25956885-25956907 GTATAAGTATGTGTGTGGTGTGG - Intergenic
1124250718 15:28104997-28105019 GTGTGTGCATGTGTGGGGTATGG + Intergenic
1124250849 15:28105773-28105795 GTGTGTGCATGTGTGGTGTGTGG + Intergenic
1124250853 15:28105799-28105821 GTGTGTGCATGTGTGGTGTGTGG + Intergenic
1124250858 15:28105825-28105847 GTGTGTGCATGTGTCGGGTGTGG + Intergenic
1124250881 15:28105956-28105978 GTGTGTGCATGTGTGGGGTGTGG + Intergenic
1124250930 15:28106333-28106355 GTGTGTGCGCGTCTGGGGTGCGG + Intergenic
1125186221 15:36933586-36933608 GTATGTGTGTGTGTGTGGTGGGG + Intronic
1125419329 15:39488321-39488343 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1125476411 15:40050812-40050834 GTGTGTGGGGGTGTGTGGTGCGG + Intergenic
1125756162 15:42066449-42066471 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1126066833 15:44832251-44832273 GTATGTGCATGTGTGAGGAGAGG - Intergenic
1126093000 15:45068300-45068322 GTATGTGCATGTGTGAGGAGAGG + Intronic
1126408332 15:48345906-48345928 GGCTGTGCACGTGTGTGAGGAGG - Intergenic
1126646451 15:50879684-50879706 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1126937377 15:53726333-53726355 GTGTGTACACGTGTGTTGGGAGG + Intronic
1126972607 15:54134058-54134080 GTGTGTGTGTGTGTGTGGTGAGG + Intronic
1127526399 15:59796438-59796460 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1127629102 15:60809619-60809641 AAATGTGCATGTGTGTGGTGGGG - Intronic
1127665844 15:61146439-61146461 GTATGTGTATGTGTGTTGGGGGG - Intronic
1128078474 15:64842442-64842464 GTGTGTGTATGTGTGTGTTGGGG + Intronic
1128078483 15:64842501-64842523 GTGTGTGTATGTGTGTGTTGGGG + Intronic
1128282548 15:66408526-66408548 GTATGTGTGCGTGTGTGTGGGGG + Intronic
1128412212 15:67411022-67411044 GCATGTGCAGGGGTGGGGTGGGG - Intronic
1128847240 15:70910133-70910155 GTATGTGCGTGTGTGTGATAAGG + Intronic
1129092271 15:73163939-73163961 GTGTGTGTATGTGTGTGGTAGGG + Intronic
1129322761 15:74783750-74783772 GTATGGCCATCTGTGTGGTGTGG + Intronic
1129460151 15:75696510-75696532 GTGTGTGCGCGTGTGTGGGCCGG + Intronic
1129933518 15:79431499-79431521 GTATGTGTGTGTGTGTGGGGGGG + Intergenic
1130371060 15:83285240-83285262 GTGTGTGTGCGTGTGCGGTGGGG - Intergenic
1130450804 15:84049951-84049973 GGCTGTGCATGTGTGTGGGGAGG - Intergenic
1131190250 15:90309445-90309467 GCATGTGCACGTGTGTGCGTTGG - Intronic
1131313004 15:91307722-91307744 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1131504802 15:93008007-93008029 GTTTGAGCATGTGGGTGGTGGGG + Intronic
1131998246 15:98154271-98154293 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1132640913 16:977973-977995 GTGCGTGTATGTGTGTGGTGGGG - Intronic
1133039224 16:3051205-3051227 GTGTGTGTATGTGTGTGGGGGGG + Intronic
1134306410 16:13037083-13037105 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
1134782367 16:16909830-16909852 GTGTGTGCGCGTGTGTGGCTGGG + Intergenic
1134807648 16:17139408-17139430 ATATGTGCTTGTGTGTGCTGGGG + Intronic
1135031935 16:19045468-19045490 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1135111410 16:19693267-19693289 GTATGTGGATGTGTGTGTTGCGG + Intronic
1135128602 16:19833091-19833113 GTGTGTGTATGTGTGTGGTGAGG + Intronic
1135529743 16:23242790-23242812 GCATACGCATGTGTGTGGTGAGG + Intergenic
1135705902 16:24674689-24674711 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1136115078 16:28089292-28089314 GTATGTGTGGTTGTGTGGTGTGG - Intergenic
1136518116 16:30780054-30780076 GAATGTGTAACTGTGTGGTGTGG + Exonic
1136605723 16:31332015-31332037 GTGTGTGCATGTGTGTGCTCAGG + Exonic
1136653485 16:31693741-31693763 GTGTGTGCATGTGTGTGCTGTGG - Intergenic
1137512878 16:49116821-49116843 TAATGTGTATGTGTGTGGTGCGG - Intergenic
1137571061 16:49566520-49566542 GGATGTGGAGCTGTGTGGTGGGG + Intronic
1138450042 16:57088244-57088266 GTATGTGTGGGTGTGTGTTGGGG - Intergenic
1139027813 16:62840440-62840462 GTATGTGTGTGTGTGTGGTAAGG + Intergenic
1139199777 16:64962573-64962595 GTATGTGCATGTGTGTGGTAGGG - Intronic
1139250648 16:65492230-65492252 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
1140245861 16:73248665-73248687 GCACGTGCACGTGTGTGTTGTGG + Intergenic
1140529883 16:75655976-75655998 GTGTGTGCACGTGTGTGTGAGGG - Intronic
1140833720 16:78774571-78774593 TTATGTGCATATGTGTGGGGGGG - Intronic
1140888722 16:79267418-79267440 GTGTGTGTACGTGTGTGGTATGG + Intergenic
1141448316 16:84078813-84078835 GTATGTGCTCATTTGTGGGGTGG + Intronic
1141492504 16:84383743-84383765 GTGTGTGTATGTGTGTGTTGGGG + Intronic
1141586172 16:85035003-85035025 GTAGGTGCACAGGTGTGGGGTGG - Intronic
1141686352 16:85572244-85572266 GTGTGTGGTTGTGTGTGGTGTGG - Intergenic
1141928870 16:87187164-87187186 ATGTGTGCATGTGTGTGGAGGGG + Intronic
1141983420 16:87563866-87563888 GTGTGTGCGCGTGTGTGTTGGGG + Intergenic
1141983423 16:87563912-87563934 GTGTGTTCATGTGTGTGCTGGGG + Intergenic
1141983456 16:87564334-87564356 GTGTGTGTGCGTGTGTGTTGGGG + Intergenic
1142240465 16:88942286-88942308 GTAAGAGCACGTGTGCGTTGGGG - Intronic
1142404799 16:89882131-89882153 GTATGTGAATGTATGTTGTGAGG + Intronic
1142431683 16:90031931-90031953 GTATGTGCAGGTGAGGTGTGGGG + Intronic
1142561604 17:812573-812595 GTGTGTGCACGTGTGTGTGATGG + Intronic
1142562020 17:815855-815877 GTGTGTGCACGTGTGTGCACAGG - Intronic
1142684552 17:1570406-1570428 GTATGGGCTTGGGTGTGGTGTGG + Intronic
1142736997 17:1907518-1907540 GCATGTGCACGTGTGTGCCCTGG + Intergenic
1143001170 17:3796177-3796199 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1143167404 17:4903789-4903811 ATGTGTGCACGTGTGTGTTTAGG - Intergenic
1143582992 17:7837043-7837065 GGAGGGGCACGGGTGTGGTGTGG + Intergenic
1143922020 17:10337477-10337499 GTATGTGCCTGTGGGTGGGGAGG + Intronic
1143997452 17:11019599-11019621 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1144175473 17:12700902-12700924 GTGTGTGTATGTGTGTGGGGGGG + Intronic
1144321189 17:14121926-14121948 ACATGTGCATGTGTGTGGTGTGG + Intronic
1145390291 17:22450554-22450576 GTGTGTGCACATGTGTGGGCCGG - Intergenic
1145860977 17:28209841-28209863 TTGTGTGTATGTGTGTGGTGAGG - Intergenic
1145977978 17:28995332-28995354 GTGTGTGCATGTATGTGGGGGGG + Intronic
1146157923 17:30539546-30539568 GAATGTGTGTGTGTGTGGTGGGG - Intergenic
1146354889 17:32125621-32125643 GTTTGTGCACGTGTGTCCTCAGG - Intergenic
1146613277 17:34327735-34327757 GTGTGTGCGTGTGTGTGGGGGGG + Intergenic
1146795120 17:35775132-35775154 GTATGTGCATGTGTGTGTTTGGG + Intronic
1146908955 17:36635685-36635707 GTGTGTGTAAGTGTGTGTTGGGG - Intergenic
1146925476 17:36741964-36741986 GTATGTGAGAGTGTGTGCTGTGG + Intergenic
1146928383 17:36760852-36760874 GTGTGTGCATGTGTGTGGATGGG + Intergenic
1147139470 17:38453297-38453319 GCAGGTGGATGTGTGTGGTGCGG + Intronic
1147382032 17:40061970-40061992 GTGTGTGTATGTGTGTGCTGGGG + Intronic
1147723088 17:42550561-42550583 ATGTGTGTACCTGTGTGGTGTGG + Exonic
1147724300 17:42556787-42556809 ATGTGTGTACCTGTGTGGTGTGG + Intergenic
1147747670 17:42705244-42705266 GGATGTGCACATGTGTGGTGGGG + Intronic
1148219394 17:45851155-45851177 ATGTGTGCAGGTGTGGGGTGTGG - Intergenic
1148228352 17:45915262-45915284 GAGTGTGTATGTGTGTGGTGTGG + Intronic
1148330173 17:46809469-46809491 GTGTGTGTACGTGTGTGTTGGGG - Intronic
1148550256 17:48545987-48546009 GTGTGTGCATGAGTGTGGTGGGG + Intergenic
1148560056 17:48601004-48601026 GTGTGTGTGTGTGTGTGGTGTGG + Intronic
1148784453 17:50139212-50139234 GTGCGTGCATGTGTGTGTTGAGG - Intronic
1148855616 17:50577751-50577773 GCAGGTGCACGTGTCTGGTGTGG + Intronic
1149039286 17:52168709-52168731 GTATGTGTGCGGGTGTGATGGGG + Intergenic
1149343892 17:55715234-55715256 GTATGTGCATGTTTCTGCTGAGG - Intergenic
1149431573 17:56598329-56598351 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1149614583 17:57987823-57987845 GTGTGTGCGTGTGTGTGCTGGGG + Intronic
1150134961 17:62690481-62690503 ACATGTGCAAGTGTGTGGGGGGG - Intronic
1150324754 17:64247800-64247822 GTATGTATATTTGTGTGGTGGGG - Intronic
1151318331 17:73337509-73337531 GTGTGTGTGTGTGTGTGGTGAGG + Exonic
1151512407 17:74569334-74569356 GTGCGTGCATGTGTGTGGAGGGG + Intergenic
1151623295 17:75260908-75260930 GTATATGTATGTGTGTGGGGGGG + Intronic
1151889035 17:76941350-76941372 GTAGGTGCACATGTGTGGGCTGG + Intronic
1151928337 17:77214759-77214781 GTATGTGAACTTGGGTGGGGGGG + Intronic
1152009034 17:77699532-77699554 GCATGTGCATGTGTTGGGTGAGG + Intergenic
1152089428 17:78238616-78238638 GCATGTGCATGTGTGTGCTGGGG + Intronic
1152095282 17:78268728-78268750 GGCTGTGCAGGTTTGTGGTGGGG + Intergenic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152191894 17:78893203-78893225 GTGTGTGCATGTGTGTGCAGGGG + Intronic
1152205579 17:78972874-78972896 GTATGTGCAGGTGTGTGTGTGGG + Intronic
1152521593 17:80859710-80859732 CTGTGTGCACGTGTGTGCGGGGG + Intronic
1152733457 17:81984995-81985017 GTGTGTGCAGGTGTGTGGGGGGG - Intronic
1152737852 17:82006077-82006099 GCGTGTGCACGTGTGTGCTTGGG + Intronic
1152840779 17:82566763-82566785 GTCTGTGCAGGTGTGGGGAGGGG - Intronic
1152859947 17:82690662-82690684 GAGTGTGCACGTGTGTGCAGGGG + Intronic
1153325525 18:3815400-3815422 GTGTGTGCACGGGTGTGCAGAGG - Intronic
1153463616 18:5364476-5364498 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
1153614290 18:6920414-6920436 GGTTGTGGAGGTGTGTGGTGTGG + Intergenic
1153943380 18:9996051-9996073 GTGCATGCACGTGTGTGTTGGGG + Intergenic
1154080252 18:11249146-11249168 GTGTGTGCATGTGTGTGCAGTGG - Intergenic
1154218151 18:12430817-12430839 GGATGTGTATGTGTGTGGTATGG + Intronic
1154223463 18:12478265-12478287 GTATGTGCATGTGTGTAGCTAGG + Intronic
1154299701 18:13182392-13182414 CTACGGTCACGTGTGTGGTGGGG + Intergenic
1154350797 18:13581901-13581923 ATGTGTGCATGTGTGTGGTAAGG + Intronic
1155360896 18:25000986-25001008 GTGTGTGCACGTGTGTATTTAGG + Intergenic
1155446146 18:25914902-25914924 GTATGTGTATGTGTGTGCTTTGG - Intergenic
1155517028 18:26634409-26634431 ATATATGCATGTGTGTGTTGTGG + Intronic
1156669612 18:39452568-39452590 GTATGTGCATGTGTGTGTAGGGG - Intergenic
1156719253 18:40049667-40049689 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
1156824996 18:41420046-41420068 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1157113759 18:44844326-44844348 GTGTGTGCACGTGTGTGTGTGGG - Intronic
1157421669 18:47552991-47553013 GTGTGTGCATGTGTGTATTGAGG + Intergenic
1157650672 18:49327021-49327043 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1157722605 18:49936995-49937017 GTATGTTAACGCCTGTGGTGGGG - Intronic
1157791437 18:50535168-50535190 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1157791440 18:50535219-50535241 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
1157791450 18:50535284-50535306 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
1158109124 18:53920420-53920442 GTGTGTGCACGTGTGTGTATGGG + Intergenic
1158109133 18:53920556-53920578 GTGCGTGTATGTGTGTGGTGTGG + Intergenic
1159014688 18:63091478-63091500 GTATTTGTGCGTGTCTGGTGTGG + Intergenic
1159016186 18:63103330-63103352 GTGTGTGCAGGTGTGTAGTGTGG + Intergenic
1159032981 18:63249950-63249972 GTATGTGCAAGTGTGCGGTGCGG - Intronic
1159087234 18:63807643-63807665 GTATGTGCATGTATGTTGTGTGG + Intergenic
1159674941 18:71271133-71271155 GTATGTGCATATGTGTTGCGGGG - Intergenic
1159963649 18:74575739-74575761 GTGTGTGCGCGTGTGTGAAGGGG + Intronic
1160047907 18:75405002-75405024 GTATGTGCATGTGTGGGGAAAGG + Intergenic
1160235666 18:77084426-77084448 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
1160357892 18:78244193-78244215 GTGTGTGCGCGTGTGTGAAGTGG - Intergenic
1160429127 18:78799557-78799579 GTATGTGTGTGCGTGTGGTGGGG - Intergenic
1160962424 19:1729306-1729328 GTATGTGCATGTGTGTGTGCAGG + Intergenic
1161417346 19:4154829-4154851 TTATGTGCACATGGGAGGTGGGG + Intronic
1161810044 19:6466355-6466377 GTATGTGTGTGTGTGTGTTGTGG + Intronic
1161839589 19:6671287-6671309 GTGTGTTCATGTGTGTGGGGAGG + Intergenic
1161887488 19:7007955-7007977 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1161967683 19:7557325-7557347 GCGTGTGCGTGTGTGTGGTGCGG - Intronic
1162015300 19:7843061-7843083 GTATGTGCATGTGTGTGTATAGG + Intronic
1162015308 19:7843177-7843199 GTATGTGCATGTGTGTGTATAGG + Intronic
1162098993 19:8328382-8328404 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1162914528 19:13866868-13866890 GTATGTGTGTGTGTGTGGTGGGG - Intronic
1163131621 19:15276976-15276998 GTGTGTGCGCTTCTGTGGTGGGG + Intronic
1163241966 19:16069990-16070012 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1164803259 19:31094946-31094968 ATATGTGTGCATGTGTGGTGGGG - Intergenic
1165196515 19:34108214-34108236 GTGTGTCCACACGTGTGGTGGGG + Intergenic
1165354972 19:35299038-35299060 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
1165984614 19:39757197-39757219 GTGTGTGCCTGTGTGTGTTGGGG + Intergenic
1166222915 19:41377047-41377069 GTACGTGTATGTGTGTGCTGGGG + Intronic
1166536196 19:43576471-43576493 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1166816827 19:45551323-45551345 GTATGTGGACTTGTCTGTTGGGG - Intronic
1167072631 19:47229801-47229823 GTGTATGTATGTGTGTGGTGGGG - Intronic
1167103465 19:47417920-47417942 GTGTGTGCATGTGTGTGTGGGGG - Intronic
1167997070 19:53414430-53414452 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1168006852 19:53497111-53497133 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1168018783 19:53594305-53594327 GGCTGTGCAGGTGTGTGTTGTGG + Intergenic
1168059203 19:53882070-53882092 GTGTGTGCACGTGTGGGGGGCGG + Intronic
925013266 2:502063-502085 GTATCTGCATGTGTGTGATTAGG + Intergenic
925071803 2:975104-975126 GTTAGTGCAAGTGTGTGGTGTGG - Intronic
925071831 2:975406-975428 GTGGGTCCAAGTGTGTGGTGTGG - Intronic
925319678 2:2952454-2952476 GTGTGTGCATGTGCGTGTTGGGG - Intergenic
925541616 2:4973727-4973749 GTGTGTCTATGTGTGTGGTGTGG + Intergenic
925572160 2:5324284-5324306 GCATCTGCATGTGTGTGGTTGGG - Intergenic
925711561 2:6746197-6746219 GCATGTGTGTGTGTGTGGTGGGG + Intergenic
925937576 2:8780526-8780548 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
926533236 2:14078580-14078602 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
926807513 2:16724724-16724746 GTATGTGTATGTGTGTGTTTAGG + Intergenic
926906129 2:17807377-17807399 GTGTGTGCTCGTGTGTGTTGGGG - Intergenic
926948527 2:18215943-18215965 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
927016676 2:18970565-18970587 GTATGTGTGTGTGTGTGTTGGGG - Intergenic
927318596 2:21716481-21716503 GTATGTGCATGTATATCGTGTGG - Intergenic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
928549308 2:32356434-32356456 GTCTGTGTGAGTGTGTGGTGGGG - Intergenic
928937678 2:36696738-36696760 GTGTGTGTATGTGTGTGGGGGGG + Exonic
929315855 2:40477753-40477775 GTGTGTGCACGTGTGTGTAGGGG + Intronic
929581802 2:43086054-43086076 GTGTGTGCACGTGTGTGGTGGGG - Intergenic
929589971 2:43138584-43138606 GTATGTGTGTGTGTGTGGTGCGG - Intergenic
929678930 2:43968869-43968891 CTGTGTGCATGAGTGTGGTGAGG - Intronic
929780842 2:44955855-44955877 GGTAGTGCACGTGGGTGGTGTGG + Intergenic
929883768 2:45860609-45860631 ATATGTGCATGTGAGTGCTGGGG + Intronic
930003464 2:46877707-46877729 GTGTGTGGGTGTGTGTGGTGTGG - Intergenic
930003539 2:46878829-46878851 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
930154429 2:48091752-48091774 GTGTGTGTCTGTGTGTGGTGAGG - Intergenic
931242487 2:60466055-60466077 GTATGTGGAAGTGGGTTGTGGGG - Intronic
931457807 2:62425880-62425902 ATATGTGCATGTGTGTGGTGAGG - Intergenic
932099191 2:68881039-68881061 GTGTGTGCCTGTGTGTGTTGGGG - Intergenic
932188497 2:69718644-69718666 GTGTATGCATGTGTGTGCTGTGG - Intronic
932242622 2:70169242-70169264 GTGTGTGTGTGTGTGTGGTGAGG - Intronic
932274280 2:70440223-70440245 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
932469212 2:71942978-71943000 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
932497233 2:72152000-72152022 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
932625163 2:73291624-73291646 GGGTGCGCACGTGCGTGGTGAGG + Exonic
933331228 2:80895524-80895546 GAATATGCATGTGTATGGTGGGG + Intergenic
933346440 2:81092209-81092231 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
933836721 2:86251755-86251777 GTATGTGGGCATGTGTGTTGGGG + Intronic
934032525 2:88061161-88061183 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
934032531 2:88061199-88061221 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
934526823 2:95057195-95057217 TTATGGACACGTGTGTGGGGAGG + Intergenic
935063074 2:99624652-99624674 CTATGTGCACGTCTGTGATGAGG - Intronic
935255383 2:101305668-101305690 GTATGTGTCTGTGTGTGTTGGGG - Intronic
935332526 2:101987597-101987619 GTAGGTGCACGTGTGTGTTTAGG - Intergenic
935345914 2:102108226-102108248 GTATGTGTGTGTGTGTGGGGGGG + Intronic
935842978 2:107133628-107133650 GTGTGTACATGTGTGTGTTGGGG + Intergenic
936339330 2:111617482-111617504 GTATGTGCGTGTGTATGGGGGGG - Intergenic
936443622 2:112577976-112577998 GTGTGTGAAAGTGTGTGGTTGGG - Intergenic
937000869 2:118466488-118466510 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
937402585 2:121597767-121597789 GTACTTGCACTGGTGTGGTGTGG + Intronic
937939654 2:127275150-127275172 TTCTTTGCTCGTGTGTGGTGGGG - Intronic
938119648 2:128624585-128624607 ATATGTGCATGCGTGTGGTGTGG - Intergenic
938140186 2:128788990-128789012 GTGTGTGCATGTGTGATGTGAGG + Intergenic
938243347 2:129759533-129759555 GCATGTGCTTGTGTGTGGTATGG - Intergenic
938719938 2:134057976-134057998 GTGTGTGTGTGTGTGTGGTGAGG - Intergenic
939724227 2:145695321-145695343 GTATGTGTGTGTGTGTGGTTGGG + Intergenic
940001356 2:148969455-148969477 GTGTGTGTATGTGTGTGGGGAGG + Intronic
940064681 2:149614154-149614176 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
940109722 2:150138213-150138235 GTATGGGCACGAGTGTGGGATGG + Intergenic
941026863 2:160465839-160465861 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
942374065 2:175317941-175317963 GCATGTGCATGTGTGTGCTGAGG + Intergenic
942406667 2:175663246-175663268 CTATGTGCACGTGTGTGTGGAGG - Intergenic
942865439 2:180668011-180668033 GTGTGTGCATGTGTGTGTTATGG + Intergenic
942982352 2:182097459-182097481 GTATGTGGTTGTTTGTGGTGGGG - Intronic
943122347 2:183752389-183752411 GTCTGTGTATATGTGTGGTGAGG - Intergenic
943585104 2:189729700-189729722 GTGTGTGTGTGTGTGTGGTGCGG + Intronic
943957161 2:194207373-194207395 GTGTGTGAGTGTGTGTGGTGGGG + Intergenic
943986707 2:194631038-194631060 GTCTTTGGATGTGTGTGGTGGGG + Intergenic
944739925 2:202601889-202601911 GTCTGTGCGTGTGTGTGCTGGGG - Intergenic
945832146 2:214800319-214800341 GTATGTGCACTTGTGTGTATTGG + Intronic
946076027 2:217074381-217074403 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
946312799 2:218892298-218892320 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
946449459 2:219767355-219767377 GTGTGTGCATGTGTGTGGGTGGG + Intergenic
946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG + Intergenic
947000693 2:225452780-225452802 ACGTGTGCATGTGTGTGGTGGGG - Intronic
947017535 2:225638176-225638198 GTGTGTGTGTGTGTGTGGTGTGG + Intronic
947099019 2:226598979-226599001 GCATGTGCATGTGTGTGTAGAGG + Intergenic
947288244 2:228542483-228542505 GTATGTTCATGTGTGGTGTGTGG + Intergenic
947612420 2:231532269-231532291 GTGTGCGCGTGTGTGTGGTGTGG - Intergenic
947693133 2:232158329-232158351 GTGTGTGCATGTGTGTGTTCGGG + Intronic
947746964 2:232512831-232512853 GCATGCGCACGTGTGTGCAGGGG + Intergenic
947917575 2:233843864-233843886 GTGTGTGCACGTGTGTGGCAGGG + Intronic
948304739 2:236938265-236938287 GTGTGTGCATGTGTGTGGTGTGG + Intergenic
948544072 2:238713565-238713587 GTATGTGTATGTGTGGCGTGTGG - Intergenic
948654398 2:239467533-239467555 GTGTGTGCATGTGTGGTGTGTGG + Intergenic
948682344 2:239644114-239644136 GTGTGTGATCGTGTGTGGTGTGG + Intergenic
948814113 2:240501002-240501024 GTATGTAGATGTGTGTGGGGCGG + Intronic
948855485 2:240728429-240728451 GTATGTGTACGTGTGTGTCCTGG - Intronic
1169582459 20:7039256-7039278 GTATGGGTACGTGTGTGTTGGGG + Intergenic
1169867436 20:10217335-10217357 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1170045629 20:12082423-12082445 GTGTGTGCACGTGTGTGTCTGGG - Intergenic
1170133203 20:13044990-13045012 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1170508176 20:17050371-17050393 GTGTGTGCACGTTAGTGGTTTGG - Intergenic
1170756364 20:19210517-19210539 GTATGTGTGTGTGTGTGGCGGGG - Intergenic
1171109985 20:22471910-22471932 ATGTGTGCACGGGTGTGCTGTGG - Intergenic
1171428992 20:25067432-25067454 ATGTGTGAATGTGTGTGGTGTGG - Intergenic
1171435422 20:25118355-25118377 GGATGTGCACGTGAGTGTGGTGG - Intergenic
1171960353 20:31489089-31489111 GTATGTGTGTGTGTGTGTTGTGG + Intergenic
1172215087 20:33230040-33230062 GCATGTGTGTGTGTGTGGTGGGG - Intergenic
1172620370 20:36314338-36314360 GTGTGTGTGTGTGTGTGGTGTGG + Intronic
1172883571 20:38217091-38217113 GTCTGTGCAAGTGGGTGGGGGGG + Intronic
1172904159 20:38356403-38356425 GTGTGCGCGTGTGTGTGGTGTGG - Intronic
1173057966 20:39634820-39634842 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1173551320 20:43934824-43934846 GTATGTGGGGGTGTGTGTTGGGG + Intronic
1173685821 20:44922735-44922757 GTATGTGTGCGTGTTTTGTGTGG - Intronic
1174136832 20:48385597-48385619 GCATGTGGGTGTGTGTGGTGTGG + Intergenic
1174407270 20:50310504-50310526 GTGTGTGCACGTATGGGGTGGGG + Intergenic
1174412283 20:50343851-50343873 GTGTGTGCATGTGTGTGGCTGGG + Intergenic
1175485933 20:59346268-59346290 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1176030232 20:63008055-63008077 GGAGCTGCACGTGTGTGGGGCGG + Intergenic
1176275993 20:64269694-64269716 GAGTGTAGACGTGTGTGGTGTGG + Intronic
1176276103 20:64270255-64270277 GTGTGGGCACGTGTGATGTGGGG + Intronic
1176366855 21:6038464-6038486 GTGTGTGCATGTATGTTGTGTGG + Intergenic
1177470228 21:21551653-21551675 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
1177662971 21:24111639-24111661 GTATGTGCATGTGTGATGTGTGG + Intergenic
1178273286 21:31213460-31213482 GTATATGCAGGTGTTTGGAGAGG - Exonic
1178750477 21:35297721-35297743 GTGTGTGCATGTGTGTGAGGGGG - Intronic
1179004320 21:37497041-37497063 GTATGTACATGTGTGTGTGGGGG - Intronic
1179129604 21:38622926-38622948 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
1179394478 21:41025322-41025344 GAATGTGCATGCATGTGGTGAGG - Intergenic
1179407757 21:41139538-41139560 GTATGTGCATGTATGATGTGTGG - Intergenic
1179413480 21:41179568-41179590 GTGAGTGCACATGTGTGGTGAGG + Intronic
1179756663 21:43500080-43500102 GTGTGTGCATGTATGTTGTGTGG - Intergenic
1180108495 21:45636028-45636050 ATATGTGTATGTGTGTGGTGTGG + Intergenic
1181746312 22:24957179-24957201 GTGTGTGCCTGTGTGTGTTGGGG + Intronic
1182236348 22:28879943-28879965 GTATGTGTGCATGTGGGGTGTGG + Intergenic
1182667253 22:31968804-31968826 GTGTGTGTGCGTGTGTGTTGGGG - Intergenic
1182966899 22:34530562-34530584 GTGTGTGCATGTGTGTGTTTGGG + Intergenic
1183027355 22:35075650-35075672 GTATGTGTGGGTGTGTGGTGGGG + Intronic
1183343673 22:37295363-37295385 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1183465041 22:37975513-37975535 GTATGTACACGTGTGTGGGAGGG + Intronic
1184265676 22:43344493-43344515 GTGTGTGCGTGTGTGTGTTGGGG - Intergenic
1184320431 22:43738666-43738688 GTATGTGCAAGTGTGTGTGATGG - Intronic
1184457172 22:44617226-44617248 CTGTGTGTACGCGTGTGGTGTGG - Intergenic
1184478209 22:44732658-44732680 GTATGTGCGTGTGCGTGCTGGGG - Intronic
1184678358 22:46055410-46055432 GTATGTGCACGTGGGTGTGCAGG + Intronic
1184821353 22:46911081-46911103 ACATGTGCACGTGTATGGTGTGG + Intronic
1184858440 22:47159763-47159785 GTCTGTGTGAGTGTGTGGTGTGG - Intronic
1184893277 22:47392278-47392300 GTGTGTGTGCATGTGTGGTGTGG - Intergenic
1184924652 22:47628761-47628783 GCATGTGAGCGTGTGTGTTGTGG + Intergenic
1184924666 22:47628913-47628935 GCATGTGAGCGTGTGTGTTGTGG + Intergenic
1184924686 22:47629105-47629127 GCATGTGCATGTGTGTGATGTGG + Intergenic
1185048753 22:48542515-48542537 GTGTGTGCATGTGTGGTGTGTGG + Intronic
1185079966 22:48704185-48704207 GTGTGTGCGCGTGTGTGTTGAGG - Intronic
1185094977 22:48801151-48801173 TTGTATGCATGTGTGTGGTGGGG - Intronic
1185107397 22:48881721-48881743 GTATGTGGTGGTGTGTGATGTGG - Intergenic
1185107441 22:48882195-48882217 GTGTCTGCACGTGGGTTGTGTGG - Intergenic
1185188549 22:49418059-49418081 GCGGGTGCACGTGTGGGGTGTGG - Intronic
1185189378 22:49424688-49424710 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1185212704 22:49580348-49580370 GTGTGTGTGGGTGTGTGGTGTGG - Intronic
1185404820 22:50641803-50641825 GTCTGTGCCTGTGTGTGGCGGGG + Intergenic
949528324 3:4928391-4928413 GTGTGTGTGCGTGTGTGTTGTGG + Intergenic
949528326 3:4928393-4928415 GTGTGTGCGTGTGTGTTGTGGGG + Intergenic
949905669 3:8856354-8856376 GTGTGTGCGTGTGTGTGGGGGGG + Intronic
950472747 3:13196774-13196796 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
950510882 3:13425862-13425884 GTGTGTGTATGTGTGTGGCGGGG - Intergenic
951425391 3:22538587-22538609 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
951437915 3:22686559-22686581 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
952089058 3:29862611-29862633 GTGTGTGTGCATGTGTGGTGGGG + Intronic
952643356 3:35625206-35625228 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
953004836 3:38968579-38968601 GTGTGTGCACATGTGTGTTGGGG - Intergenic
953391084 3:42534135-42534157 GTATATGCACTGGTGTGGGGAGG + Intronic
953743181 3:45554348-45554370 ACGTGTGCATGTGTGTGGTGTGG - Intergenic
953890063 3:46744692-46744714 AAATGAGCACGTGTGTGGAGGGG - Exonic
953914290 3:46908802-46908824 GGATGTGCACGTGTGTGTGCAGG + Intergenic
954583670 3:51717300-51717322 GTAAGTGCATGTATGTGGGGTGG - Intronic
954594227 3:51811636-51811658 GTGTGTGCATGTGTGAGGTGTGG - Intergenic
954745545 3:52785607-52785629 GTATGTGCACCTGTGTGTGGTGG + Intronic
954792048 3:53140737-53140759 GTGTGTTCACCTGTGTTGTGTGG + Intergenic
954978258 3:54717728-54717750 GTGTGTGTGCATGTGTGGTGTGG + Intronic
955530817 3:59871449-59871471 GTATGTGTGCGTGTGTGGGGGGG - Intronic
956167716 3:66408946-66408968 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
956369196 3:68539704-68539726 GTGTGTGCATGTGTGTGGTGGGG + Intronic
956537757 3:70297001-70297023 GTATGTGCGTATGTGTGGTGGGG - Intergenic
956638439 3:71390559-71390581 GGATGTGTGTGTGTGTGGTGGGG + Intronic
956933797 3:74076640-74076662 GTGTGTGTGTGTGTGTGGTGAGG - Intergenic
957605819 3:82397920-82397942 GTATGCGCACGTGTGTGTTTTGG - Intergenic
957800686 3:85076323-85076345 GTGTGTGTGTGTGTGTGGTGTGG + Intronic
958109335 3:89119761-89119783 GTATGTGCACATGTGTGTTTGGG + Intronic
959440821 3:106373349-106373371 GTATGTGCACGTGTGCACTTTGG + Intergenic
960013762 3:112862066-112862088 GTATGTGTCTGTGTGTGGTGGGG - Intergenic
960015914 3:112887685-112887707 GGCTGTGCATGTGTGTGGGGAGG - Intergenic
960133467 3:114082199-114082221 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
960692660 3:120363177-120363199 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
960717112 3:120586766-120586788 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
961388805 3:126539862-126539884 GTTTGTGTGTGTGTGTGGTGTGG - Intronic
961507815 3:127382923-127382945 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
961519389 3:127457919-127457941 GCACGTGCATGTGTGTGTTGGGG - Intergenic
961673316 3:128549984-128550006 GTAAGTTCACTTGTGTGGGGAGG - Intergenic
962143099 3:132811256-132811278 GTATGTGTGTGTGTGTGGTAGGG + Intergenic
962254938 3:133864148-133864170 GTTTGTGTGCGTGTGTGGGGGGG + Intronic
962481371 3:135801318-135801340 GACTGTGTAAGTGTGTGGTGAGG + Intergenic
962577397 3:136767458-136767480 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
963303975 3:143629587-143629609 GTGTGTGTATGTGTGTAGTGGGG + Intronic
963343339 3:144064343-144064365 GTATGTGTGTGTGTGTGGTGGGG + Intergenic
963350911 3:144149907-144149929 GTGTGTGTATGTGTGTTGTGGGG - Intergenic
964527743 3:157632969-157632991 GTGTGTGTATGTGTGTGGTGGGG - Intronic
964720225 3:159763283-159763305 GTATGTGCGTGTGTGAGGGGAGG + Intronic
966471595 3:180295282-180295304 GTATGTGCGTGTGTGTGTAGGGG - Intergenic
966766087 3:183463872-183463894 ATATGTGCATGTGTGGGGTGGGG + Intergenic
966857125 3:184202430-184202452 GTGTGTGCATGTGTGTGCAGTGG - Intronic
967089813 3:186125904-186125926 GTGTGTGTGTGTGTGTGGTGAGG + Intronic
967089929 3:186126622-186126644 GTGTGTGTGTGTGTGTGGTGTGG + Intronic
967449534 3:189608165-189608187 GTGTGTGCATGTATGTGTTGGGG + Intergenic
967748724 3:193088932-193088954 GTGTGTGCATGTGTGTGTGGGGG - Intergenic
968627632 4:1634337-1634359 GTGTGTGGACGGGTGTGGAGGGG - Intronic
968637754 4:1690803-1690825 GTGTGTGCATGTGTGTGGTGGGG - Intergenic
968660635 4:1797417-1797439 CCATCTGCCCGTGTGTGGTGGGG - Intronic
968950047 4:3685954-3685976 GTGTGCACACGTGTGTGGGGGGG - Intergenic
968955100 4:3714820-3714842 GTGTGTGTACGTGTGATGTGTGG + Intergenic
969103023 4:4784310-4784332 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
969125493 4:4945067-4945089 GTGTGTGTATGTGTGTGGGGGGG - Intergenic
969301417 4:6299482-6299504 GGGTGTGCACGTGTGTGTAGGGG + Intronic
969301497 4:6299965-6299987 GTGTGTGCACGTGTGTGTACGGG + Intronic
969323268 4:6425918-6425940 GCATGTGCATGTGTGTTGCGGGG + Intronic
969411010 4:7028157-7028179 GTATGTGCATGTGAGGTGTGTGG - Intronic
969609310 4:8218130-8218152 GTGTGTGCACGTGTGTGTGTTGG + Intronic
970199134 4:13584402-13584424 GCATGTGTGCGTGTGTGGCGGGG + Intronic
970723376 4:19014273-19014295 GTGCATGCACATGTGTGGTGTGG + Intergenic
971012554 4:22454660-22454682 ACATGTGTCCGTGTGTGGTGTGG + Intronic
971342523 4:25783637-25783659 GTATGTGCATGTGTGGGTGGGGG + Intronic
971618680 4:28827693-28827715 GTGTGTGTAAGTGTGTGGTGAGG - Intergenic
972167700 4:36307560-36307582 GAATGTGTATGTGTGTGGGGAGG + Intronic
972873481 4:43329215-43329237 GTTTGTGTATGTGTGTGTTGGGG + Intergenic
973947837 4:55978022-55978044 GCATGTGCATGTGTGTGTTTAGG + Intronic
974364977 4:60934884-60934906 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
974411781 4:61550992-61551014 GTATGTGTATGTGTGTGATTAGG + Intronic
974413740 4:61577194-61577216 GTGTGTGCATGTGTGTGTTAGGG + Intronic
974622705 4:64381877-64381899 GCAAGTGCACGTGTGTGTGGGGG + Intronic
974867120 4:67594942-67594964 GTGTGTGCATGTGTGTGATTGGG + Intronic
975601784 4:76107943-76107965 GTGTGTGCATGTGTGTGTTGGGG + Intronic
975665622 4:76732252-76732274 GTGTGTGCATGTGTGTTGGGGGG + Intronic
975986883 4:80208255-80208277 GTATGTGTATATGTGTGGTGTGG - Intergenic
976516334 4:85971758-85971780 GTATGTGTCCGTGGGTGGGGTGG - Intronic
976657450 4:87504167-87504189 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
977065351 4:92306012-92306034 GTATGTGTATGCGTGTTGTGCGG - Intronic
977127663 4:93189768-93189790 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
977822514 4:101490812-101490834 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
979882578 4:125980260-125980282 GCATGTGCATGTGTGTGGGGAGG + Intergenic
980091731 4:128450019-128450041 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
980206740 4:129729522-129729544 GTATGTATGCGTGTGTGGTAGGG + Intergenic
981635372 4:146872219-146872241 GTGTGTGCACATGTGGTGTGAGG - Intronic
981876103 4:149547646-149547668 GTAAGTGTGAGTGTGTGGTGAGG - Intergenic
981920012 4:150077314-150077336 GTGTGTGCGTGTGTTTGGTGGGG + Intergenic
981937405 4:150251303-150251325 GTATGTGGGGGTGTGTGGTGTGG - Intronic
982425751 4:155257667-155257689 TTCTGTGCAAGTGTGTGTTGGGG + Intergenic
982493833 4:156065172-156065194 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
983518239 4:168679108-168679130 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
983518326 4:168679497-168679519 GTGTGTGTTTGTGTGTGGTGGGG + Intronic
983662788 4:170147221-170147243 GTGTGTGTGTGTGTGTGGTGAGG + Intergenic
983804124 4:171971889-171971911 GTATGTGTGTGTGTGTGGTCTGG + Intronic
983879638 4:172918539-172918561 GTCTGTGAATGTGTGTGTTGGGG - Intronic
984155803 4:176195211-176195233 GTGTGTGTACGTGGGTGGGGGGG + Intronic
984319778 4:178179027-178179049 GTATGTGTATGTGTGTGGAGGGG - Intergenic
984603853 4:181760955-181760977 GTGTGTGTATGTGTGTGGTGGGG - Intergenic
984867294 4:184292605-184292627 GTATGTGCGAGTGTGTGTGGAGG + Intergenic
985070287 4:186160775-186160797 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
985528633 5:420935-420957 GTATGTGCGCCTGTGTGGGTGGG - Intronic
985795728 5:1960717-1960739 GTGTGTGCATGTGTGTTTTGGGG - Intergenic
985795753 5:1961196-1961218 GTGTGTGCATGTGTGTGATCAGG - Intergenic
985982627 5:3484421-3484443 GTGTGTGCATATGTGTAGTGTGG - Intergenic
986169614 5:5304958-5304980 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
986169619 5:5305008-5305030 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
986169626 5:5305058-5305080 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
986169629 5:5305084-5305106 GGATGTGTGTGTGTGTGGTGTGG - Intronic
986169639 5:5305144-5305166 ATATGTGTGTGTGTGTGGTGTGG - Intronic
986169659 5:5305287-5305309 GGATGTGTGTGTGTGTGGTGTGG - Intronic
986169664 5:5305328-5305350 GGATGTGTGTGTGTGTGGTGTGG - Intronic
986169681 5:5305450-5305472 GGATGTGTGTGTGTGTGGTGTGG - Intronic
986251299 5:6060846-6060868 GTGTGTGCACATGTGTGCGGGGG - Intergenic
986340577 5:6785700-6785722 ATATGTGCATGTGTGTAGTATGG + Intergenic
986798996 5:11240456-11240478 GTATGTGAGTGTGTGTGTTGGGG - Intronic
986859859 5:11914226-11914248 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
987095553 5:14546260-14546282 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
987201446 5:15581785-15581807 GTGTGTGAATTTGTGTGGTGGGG + Intronic
987385439 5:17324814-17324836 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
987544345 5:19293197-19293219 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
987629540 5:20450582-20450604 GTATGTGTGTCTGTGTGGTGTGG - Intronic
987761286 5:22165469-22165491 GTATGTGTATGTGTGTTGGGAGG - Intronic
987882301 5:23763842-23763864 GTGAGTGCATGTGTGTGGGGGGG + Intergenic
988841431 5:35087442-35087464 GTGTGTGTGTGTGTGTGGTGAGG + Intronic
988935767 5:36081582-36081604 GTGTGTGCATGTGTGTGGGTGGG - Intergenic
989033991 5:37150507-37150529 GTGTGCGCGCGTGTGTGTTGGGG - Intronic
989131353 5:38110260-38110282 GTGTGTGCGTGTGTGTGTTGAGG - Intergenic
990602162 5:57369989-57370011 GTATGTGCATGTGTGGGGACGGG - Intergenic
990719152 5:58673769-58673791 GTATCTGCATGTGTTTGATGAGG + Intronic
991449168 5:66733315-66733337 CTCTGTGCATGTGTGTGGTGGGG - Intronic
991471316 5:66971748-66971770 GCATGTGTATGTGTGTGTTGGGG + Intronic
991896077 5:71398923-71398945 GTATGTGTATGTGTGTTGGGAGG - Intergenic
992773683 5:80071641-80071663 GTGTGTGTATGTGTGTGTTGGGG - Intronic
992785515 5:80167113-80167135 GTATGTGCAGGTTTGTTGTAAGG + Intronic
992866202 5:80960114-80960136 GTGTGAGCGGGTGTGTGGTGCGG + Intergenic
994136365 5:96291870-96291892 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
995709098 5:115016537-115016559 GTCTGTGCATGTGTGGGGAGAGG + Intergenic
996145861 5:119975306-119975328 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
996283183 5:121757070-121757092 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
996300268 5:121973598-121973620 GTGTGTGCATGTGTGTGTGGGGG + Intronic
996401473 5:123068115-123068137 GCACGCGCGCGTGTGTGGTGTGG + Intergenic
996979392 5:129471601-129471623 GTAGGTGAACTTGTGTGATGGGG + Intronic
997830692 5:137147086-137147108 GTATGTGTGTGTGTGAGGTGGGG + Intronic
998094548 5:139389906-139389928 GTGTGTGTGCTTGTGTGGTGTGG + Exonic
998245389 5:140497872-140497894 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
998903617 5:146880209-146880231 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
999117882 5:149180353-149180375 GTATGTGTACATGTGTATTGGGG - Intronic
999270984 5:150296281-150296303 GTGTGTGCATGTGTGTCCTGGGG - Intergenic
999319685 5:150605739-150605761 GTATGTGTGTGTGTGTGGTGGGG - Intronic
999533922 5:152495638-152495660 GTATGTGCATGTGTGTGGAATGG - Intergenic
999652218 5:153778646-153778668 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
999844291 5:155461507-155461529 GTATGTGCATGTGCGTGTTTGGG - Intergenic
1000051254 5:157564679-157564701 GTAAGTGTATGTATGTGGTGCGG + Intronic
1000760145 5:165213496-165213518 GTATGTGCACATGTGTGCTGGGG - Intergenic
1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG + Intergenic
1000937921 5:167325565-167325587 GTAAGTCCACTTGTGTGGTAAGG - Intronic
1001001646 5:168013099-168013121 GTGTGTGTAAGTGTGTGTTGGGG - Intronic
1001010157 5:168090213-168090235 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1001071602 5:168590071-168590093 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1001254376 5:170172157-170172179 GTATGTGTCTGTCTGTGGTGGGG - Intergenic
1002254995 5:177952049-177952071 GTCTGTGCGTGTGTGTGCTGGGG + Intergenic
1002257118 5:177966174-177966196 GTTTGTGCGCGTGGGCGGTGGGG + Intergenic
1002543970 5:179926059-179926081 AAATGTGCACTTGTGTGGGGTGG + Intronic
1002840619 6:902272-902294 GTGTGTGCATGTGTGTTGAGGGG + Intergenic
1003146705 6:3516041-3516063 GTGTGTGTGTGTGTGTGGTGAGG - Intergenic
1003476066 6:6484221-6484243 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1003749031 6:9035549-9035571 GTATGTGTATGTGTGTGGGGGGG - Intergenic
1003917928 6:10805052-10805074 GTGTGTGCATGTGTGTGTCGGGG + Intronic
1004178895 6:13364471-13364493 GTATTTGCACGAGAGTGGTTTGG - Exonic
1004351960 6:14898005-14898027 GTGTGTGCGCGTGTGTGTGGTGG - Intergenic
1005140704 6:22628298-22628320 GTAGGTAAACTTGTGTGGTGGGG + Intergenic
1005155398 6:22799855-22799877 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1005188200 6:23186551-23186573 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1005199254 6:23324705-23324727 GTGTGTGTATGTGTGTGTTGGGG - Intergenic
1005485765 6:26297825-26297847 GAGTGTGTATGTGTGTGGTGGGG - Intergenic
1006094460 6:31647269-31647291 GTAGGTGCAGGATTGTGGTGGGG - Intronic
1006173139 6:32106980-32107002 GTGTGTGCACGTGTGTGCATGGG - Intronic
1006181453 6:32155602-32155624 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1006804178 6:36777761-36777783 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1006923088 6:37638943-37638965 GTGTGTGCATGTGTGTGTTTGGG - Intronic
1007263578 6:40581026-40581048 GTATGTGCACATGTATGTGGTGG + Intronic
1007325743 6:41058273-41058295 GTGTGTGTGGGTGTGTGGTGGGG - Intronic
1007325761 6:41058394-41058416 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1007362843 6:41371263-41371285 GTATGTGTGTGTGTGTGGGGGGG - Intergenic
1007380411 6:41486828-41486850 GCAAGTGCATGTGTGTGCTGGGG + Intergenic
1007384260 6:41510047-41510069 GTGTGTGTACGTGTGTGTTGGGG - Intergenic
1007411272 6:41663341-41663363 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1007540806 6:42642303-42642325 ATGTGTGCATGTGTGTGATGTGG - Intronic
1007769540 6:44181485-44181507 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
1007769578 6:44182280-44182302 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
1007784490 6:44271892-44271914 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1007915122 6:45554247-45554269 GTATGTGTCTGTGTGTGGTGTGG + Intronic
1008246415 6:49179230-49179252 GTAGGTTCACTTGTCTGGTGAGG - Intergenic
1008585380 6:52943752-52943774 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1008585559 6:52945158-52945180 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1009191838 6:60638631-60638653 CTATGTGGTCCTGTGTGGTGTGG + Intergenic
1009752500 6:67890073-67890095 GTGTGTGGCTGTGTGTGGTGGGG - Intergenic
1010120579 6:72371169-72371191 GTGTGTGCACATGTGTGGTCTGG + Intronic
1011172763 6:84524307-84524329 GCATGTGCACGTGTGTGATGGGG + Intergenic
1011372948 6:86659099-86659121 GTATGTGTGTGTGTGTGCTGAGG - Intergenic
1012254132 6:97013531-97013553 GTCTGTGTATGTATGTGGTGGGG - Intronic
1012443992 6:99290096-99290118 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1013000000 6:106012509-106012531 GTGTGTGCATGTGTGTAGTATGG - Intergenic
1013072855 6:106744573-106744595 GTATGTGCATGTGTGTGTAGGGG + Intergenic
1014141152 6:117944572-117944594 GTATGTGTATGTGTGTGTTTTGG - Intronic
1014322873 6:119952900-119952922 GGTTATGCACATGTGTGGTGAGG + Intergenic
1014911927 6:127104859-127104881 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1015190344 6:130465272-130465294 GTGTGTGTGTGTGTGTGGTGAGG + Intergenic
1015337611 6:132058525-132058547 GTGTGTGCATGTGTGTAGTAAGG + Intergenic
1015865946 6:137726717-137726739 TTGTGTGTATGTGTGTGGTGGGG - Intergenic
1016273992 6:142326791-142326813 GTGTGTGTATGTGTGTGGAGGGG + Intronic
1016551759 6:145288960-145288982 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
1016892795 6:149023134-149023156 GTGTGTGTGTGTGTGTGGTGTGG + Intronic
1017029634 6:150209598-150209620 GTGTATGCATGTGAGTGGTGTGG + Intronic
1017152922 6:151297200-151297222 GTATGTGTGTGTGTGTTGTGGGG + Intronic
1017326155 6:153143510-153143532 GCATGTTCATGGGTGTGGTGAGG + Intergenic
1017907330 6:158765712-158765734 GTGTGTGCTTGTGTGTGGGGTGG - Intergenic
1017918660 6:158853089-158853111 GTGTTTGTATGTGTGTGGTGGGG - Intergenic
1018090820 6:160346202-160346224 GTGTGTGAGTGTGTGTGGTGGGG + Intergenic
1018461312 6:164001836-164001858 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
1018656315 6:166040595-166040617 CTATGTGCCAGTGGGTGGTGGGG - Intergenic
1018935333 6:168270476-168270498 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
1019116474 6:169767817-169767839 GTATGTGCATATGTGGTGTGGGG - Intronic
1019487276 7:1295161-1295183 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1019487287 7:1295225-1295247 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1019487353 7:1295535-1295557 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1019553836 7:1618785-1618807 GTGTGTGTAGGTGTGTGGAGGGG + Intergenic
1020114635 7:5469594-5469616 AGATGAGAACGTGTGTGGTGTGG + Intronic
1020672862 7:11140143-11140165 GTATGTACAGGTGTGTGCAGGGG - Intronic
1020877673 7:13718505-13718527 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1021157997 7:17235795-17235817 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1021243701 7:18236245-18236267 GTGTGTGCAGGTCTGAGGTGGGG - Intronic
1021446696 7:20741775-20741797 GTGTGTGCATGTGTGTGTGGTGG - Intronic
1022248070 7:28580424-28580446 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1022528814 7:31054292-31054314 GTTTGTCCCCATGTGTGGTGAGG + Intronic
1022816480 7:33919044-33919066 ATGGGTGCACGTGTGTGGGGGGG + Intronic
1023680900 7:42686046-42686068 CTGTGTGCATGTGTGGGGTGGGG + Intergenic
1024970783 7:55068114-55068136 GTGTGTGTGCATGTGTGGTGGGG + Intronic
1026012268 7:66645845-66645867 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
1026053817 7:66967925-66967947 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1026191638 7:68133806-68133828 GTATGTGTGTGTGTGTGTTGTGG - Intergenic
1028625055 7:92868621-92868643 CTCTATGCACATGTGTGGTGTGG - Intergenic
1028722066 7:94044689-94044711 GTATGTGCACATTTGTGTTAGGG + Intergenic
1028871038 7:95772121-95772143 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
1029043614 7:97603659-97603681 GTGTGTGCATGTGTGTATTGTGG + Intergenic
1029704647 7:102269906-102269928 CTAAGGGCATGTGTGTGGTGGGG - Intronic
1030757675 7:113308396-113308418 TTATGAGCACTTGGGTGGTGGGG + Intergenic
1031052769 7:116961578-116961600 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1031336196 7:120535891-120535913 GTGTGTGTATGTGTGTTGTGGGG + Intronic
1032010361 7:128342943-128342965 CTATGTGCATGTGTATAGTGGGG - Intronic
1032023366 7:128422163-128422185 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
1032709605 7:134450414-134450436 GTGTGTGCACGTGCCTGGAGGGG + Intronic
1032815071 7:135465294-135465316 GTATATACACATGTCTGGTGTGG - Intronic
1032929305 7:136647978-136648000 GTATTTACAAGAGTGTGGTGGGG + Intergenic
1033397035 7:140985244-140985266 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1033422498 7:141216467-141216489 GTGTGTGTGGGTGTGTGGTGGGG + Intronic
1033618561 7:143041025-143041047 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1033822785 7:145153974-145153996 GTGTGTGTATGTGTGTAGTGGGG + Intergenic
1034869547 7:154671849-154671871 GTGTGTGCATGTGTGTGTTGGGG - Intronic
1035217906 7:157383627-157383649 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1035245027 7:157557326-157557348 GGATGTGCATGTGTGATGTGGGG - Intronic
1035268760 7:157707385-157707407 CTATCTCCACGTGTGTGGGGGGG - Intronic
1035351387 7:158248599-158248621 GTATGTGCATGTATGTGATGTGG - Intronic
1035351400 7:158248833-158248855 GTATGTGCATGTATGTGACGTGG - Intronic
1035351405 7:158248946-158248968 GTATGTGCATGTATGTGATGTGG - Intronic
1035368733 7:158364966-158364988 GTGTGTGAATGTGTGTGTTGTGG - Intronic
1035440223 7:158891141-158891163 GTCTGTGCACCTGTTTGCTGAGG + Intronic
1036018440 8:4814242-4814264 GTGTGTGTATGTGTGTGGTGGGG + Intronic
1036183124 8:6601746-6601768 GTGTGTGTGTGTGTGTGGTGTGG - Intronic
1036201532 8:6774715-6774737 GCGTGTGCACCTGTGTGCTGAGG - Intergenic
1036208894 8:6826337-6826359 GTGTGTGCACGCATGTAGTGTGG + Intronic
1037231652 8:16665831-16665853 GTATGTATGCGTGTGTGTTGGGG - Intergenic
1037530544 8:19768501-19768523 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1037619876 8:20554445-20554467 GTGTGTGTGTGTGTGTGGTGAGG + Intergenic
1037815944 8:22111944-22111966 ATATGTGCGCATGTGCGGTGGGG + Intergenic
1037895662 8:22652505-22652527 GCATGTGCGCATGTGTGGTGGGG + Intronic
1038155855 8:24989675-24989697 GTGTGTGTGTGTGTGTGGTGAGG + Intergenic
1038835612 8:31118236-31118258 GTATATGCATGTATGTGTTGCGG + Intronic
1039359670 8:36862558-36862580 GAAGGTGCATGTGTGTGGGGTGG - Intronic
1039364816 8:36918593-36918615 GTATGTGTGTGTGTGTGGTGGGG - Intronic
1040777698 8:51066901-51066923 ATATGTGTGCGTGTGTTGTGGGG - Intergenic
1040978281 8:53217888-53217910 GAGTGTGCGCGTGTGTGGGGGGG + Intergenic
1041065855 8:54082282-54082304 GTATGTGCGTGTGCGTTGTGGGG - Intronic
1041195470 8:55397623-55397645 GTGTGTGTGCATGTGTGGTGGGG - Intronic
1041372756 8:57180573-57180595 GTGTGTACACATGTGTGTTGGGG + Intergenic
1041565393 8:59271943-59271965 GTGTGTGTTTGTGTGTGGTGTGG + Intergenic
1041864199 8:62550407-62550429 GTGTGCGCGTGTGTGTGGTGGGG + Intronic
1041990543 8:63985001-63985023 GTGTGTGTGCGTGTGTGTTGAGG + Intergenic
1042188239 8:66158136-66158158 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1042504813 8:69548917-69548939 GTGTGTGTATGTGTGTGGGGAGG - Intronic
1042780710 8:72487929-72487951 ATATGTGCATGTTTGTGATGAGG - Intergenic
1043054125 8:75415759-75415781 GTGTGTGCACGTGTGTGTGTTGG + Intronic
1044037122 8:87320600-87320622 GTATGTGCACGTGTGTGTGTGGG + Intronic
1044212247 8:89563323-89563345 GCAGGTGCATGTGTGTGATGGGG - Intergenic
1044390506 8:91644953-91644975 GTGTGTGTGCGTGTGTGGCGGGG + Intergenic
1044630277 8:94271883-94271905 GTGTGTGCACATGTGGGGGGAGG + Intergenic
1044630284 8:94271918-94271940 GTGTGTGCACATGTGGGGGGAGG + Intergenic
1044646496 8:94449195-94449217 GTCTGTGTGTGTGTGTGGTGGGG - Intronic
1045052184 8:98337403-98337425 GTGTGTGTGTGTGTGTGGTGAGG - Intergenic
1045594538 8:103636795-103636817 GTATGTGTGTGTGTGTGGGGGGG - Intronic
1045739139 8:105334144-105334166 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1046019868 8:108651661-108651683 GTGTGTGTATGTGTGTGGTTGGG + Intronic
1046530768 8:115442585-115442607 GTGTGTGCATGTGTGTGTTTGGG + Intronic
1046739614 8:117814247-117814269 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1046808831 8:118510209-118510231 GTATGTGTGTGTGTGTGGTGGGG - Intronic
1047136431 8:122083928-122083950 GCATGTGTCTGTGTGTGGTGTGG + Intergenic
1047143790 8:122173616-122173638 GTGTGTGTACGTGTGTTGGGAGG - Intergenic
1047852730 8:128876387-128876409 GTATGTGTTTGTGTGTGTTGTGG - Intergenic
1048254127 8:132892655-132892677 GTGTGTGTATGTGTGTGCTGTGG + Intronic
1048254142 8:132892825-132892847 GTGTGTGTATGTGTGTGGTGTGG + Intronic
1048293014 8:133194645-133194667 GCGTGTGTGCGTGTGTGGTGGGG + Intronic
1048571787 8:135662872-135662894 GTGTGTGTGTGTGTGTGGTGCGG - Intergenic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1049032347 8:140047220-140047242 GTGCGTGCGCGTGTGTGATGTGG - Intronic
1049039611 8:140102468-140102490 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1049055526 8:140233618-140233640 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1049398602 8:142413558-142413580 GTGTGTGCACGTGTGTGTGTGGG - Intergenic
1049452367 8:142669194-142669216 GTGTGTGCGTGTGTGTGTTGGGG + Intronic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1049908670 9:244271-244293 GTGTGTGTGTGTGTGTGGTGGGG - Intronic
1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG + Intergenic
1050146178 9:2570064-2570086 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1050253827 9:3773491-3773513 GTATGTGCATGTGTATGTAGAGG + Intergenic
1050388998 9:5117138-5117160 GCAGGTTCAGGTGTGTGGTGAGG - Intronic
1050839054 9:10123317-10123339 GTGTGTGAACTTGTGAGGTGAGG + Intronic
1052861698 9:33441724-33441746 GTGTGTGCATGTGTGTGCAGGGG - Exonic
1053217987 9:36288687-36288709 ATGTGTGCAAGTGCGTGGTGTGG + Intronic
1054456275 9:65432053-65432075 CTGTGTGCATGTGTGTGGGGGGG - Intergenic
1054712878 9:68529195-68529217 GTGTGTGTGTGTGTGTGGTGAGG + Intronic
1054750641 9:68902126-68902148 TTACATGCACATGTGTGGTGGGG + Intronic
1055115748 9:72603422-72603444 GTATGTGTGCGTGTGGAGTGTGG - Intronic
1055326713 9:75137913-75137935 GTATGTGTACACGTGTGTTGGGG + Intronic
1055400202 9:75915258-75915280 GTTTGTGCAATTGTGTGATGAGG + Intronic
1055424569 9:76180979-76181001 GTATGTGCATGTGTGAGTGGTGG - Intronic
1055433424 9:76268276-76268298 GTATGTGCGTATGTGTGGGGTGG - Intronic
1055435649 9:76289464-76289486 GTGTGTGTGTGTGTGTGGTGAGG - Intronic
1055589278 9:77793696-77793718 GCATGTGTATGTGTGTGTTGGGG - Intronic
1055839039 9:80480511-80480533 GTGTGTACATGTGTGTGGTGAGG + Intergenic
1055880611 9:80998006-80998028 GTATGTACATGTGTTTTGTGTGG - Intergenic
1056125461 9:83532610-83532632 GCATGCACATGTGTGTGGTGGGG - Intronic
1056710209 9:88986457-88986479 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
1056753956 9:89371052-89371074 GTATGTGTATGTCTGGGGTGTGG + Intronic
1056836292 9:89958268-89958290 GTATGTGCGTGTGTGTGGCAGGG + Intergenic
1056859006 9:90162347-90162369 GTTTGTGCATGTGTATTGTGTGG - Intergenic
1056910323 9:90694864-90694886 GTGTGTGAATGTGTGTGGGGGGG + Intergenic
1057074882 9:92133415-92133437 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1058299272 9:103349742-103349764 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1058327164 9:103713145-103713167 GTATGTGCGTGTGTGAGCTGGGG - Intergenic
1058424541 9:104864972-104864994 GGCTGTGCACGTGCATGGTGTGG + Intronic
1058622607 9:106899224-106899246 GTATGTGTGTGTGTGTGGGGGGG + Intronic
1058983970 9:110195070-110195092 GTGTGTGCATGTGTGTGTGGAGG - Intronic
1059043265 9:110837657-110837679 GTATGTGCAGTTTTGAGGTGTGG + Intergenic
1059319856 9:113461221-113461243 GTGTGTGCACATGTGTGAGGTGG + Intronic
1059322884 9:113483108-113483130 GTATGTGAAGGTATGTGGTGGGG + Exonic
1059332075 9:113542011-113542033 GTGTGTGCACGTGTGTGTGTTGG - Intronic
1059516542 9:114901039-114901061 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1060662026 9:125410236-125410258 GTATGTGTGTGTGTGTGGTGTGG - Intergenic
1060707889 9:125823086-125823108 GTATGTGTAAGTTTGTGGTATGG + Intronic
1060811127 9:126612047-126612069 GTGTGTGTTTGTGTGTGGTGGGG - Intergenic
1061307515 9:129740595-129740617 GCATGTGCATATGTGTGGTGGGG + Intronic
1062119923 9:134828983-134829005 GTGTGTGCGCGTGCATGGTGTGG - Intronic
1062197990 9:135285216-135285238 GCATGTGCACGTGTGTGCCTGGG - Intergenic
1062198177 9:135286217-135286239 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198185 9:135286280-135286302 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198211 9:135286464-135286486 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062294608 9:135817727-135817749 AGGTGTGCACGTGTGGGGTGGGG + Intronic
1062325558 9:136010915-136010937 GTGTGTGCAGGGGTGTGGTGAGG - Exonic
1062328445 9:136023958-136023980 GCATGTGCACGTGTGTGTGGGGG - Intronic
1062444160 9:136586469-136586491 GTGTGTGCCCGTGTGTGTAGAGG + Intergenic
1062549416 9:137079049-137079071 GTTTGTGCACGTGTACTGTGTGG + Exonic
1062553498 9:137101755-137101777 GTATGTGCATGTGTGTTTTCAGG + Intronic
1202784695 9_KI270718v1_random:37863-37885 GTAGATTCATGTGTGTGGTGTGG + Intergenic
1185480190 X:440363-440385 GTGTGTGCACCTGTGTGTGGGGG - Intergenic
1185480199 X:440456-440478 GTATGTGCACCTGTGTGGGGGGG - Intergenic
1185763966 X:2709569-2709591 GTATGTGTGGGTGTATGGTGTGG - Intronic
1185833853 X:3327291-3327313 GTATGTGTATGTGTGTTGGGGGG - Intronic
1186037562 X:5441281-5441303 GGCTGTGCATGTGTGTGGGGAGG + Intergenic
1186229529 X:7438549-7438571 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1186368260 X:8918892-8918914 GTGTGTGTGTGTGTGTGGTGGGG - Intergenic
1186750255 X:12614376-12614398 GTGTGTGTGTGTGTGTGGTGAGG - Intronic
1186826214 X:13342511-13342533 GTGTGTGTGTGTGTGTGGTGAGG + Intergenic
1186861570 X:13677660-13677682 GTATGTGCGCGTGTGTGTGGGGG + Intronic
1187308922 X:18122241-18122263 GTGTGTGTATGTGTGTGTTGAGG - Intergenic
1187678621 X:21743402-21743424 GTGTGTGCACGTGTGTGTGGTGG - Intronic
1187940502 X:24376172-24376194 GTGTGTGTGTGTGTGTGGTGGGG + Intergenic
1187955067 X:24509485-24509507 GTATGTGTATGTGTGTGTTGGGG - Intronic
1188231791 X:27673042-27673064 GTGTGTGTATGTGTGTGGTGGGG - Intronic
1188454746 X:30351221-30351243 GTAGGTATACGTGTGTTGTGGGG + Intergenic
1189241709 X:39529675-39529697 GTGTGTGCGTGTGTGTGGTGGGG - Intergenic
1189558302 X:42167187-42167209 GCATGTGTAGGTGTGTGGTAGGG - Intergenic
1190199324 X:48346595-48346617 GTGTGTGTGTGTGTGTGGTGTGG + Exonic
1190596709 X:52059428-52059450 GTATGTGCACGTGGGTGCGAGGG + Intergenic
1190612115 X:52194645-52194667 GTATGTGCACGTGGGTGCGAGGG - Intergenic
1190655031 X:52604090-52604112 GTGTGTGTGTGTGTGTGGTGTGG - Intergenic
1190666092 X:52697074-52697096 GTGTGTGTGTGTGTGTGGTGTGG + Exonic
1190673326 X:52761336-52761358 GTGTGTGTGTGTGTGTGGTGTGG - Exonic
1191841398 X:65515794-65515816 GTGTGTACACATGTGTGGGGAGG - Intronic
1192141951 X:68653585-68653607 GTGTGTGTGCTTGTGTGGTGTGG - Intronic
1192168845 X:68842212-68842234 GTGTGCGTGCGTGTGTGGTGGGG + Intergenic
1192239378 X:69317240-69317262 GTATGTGCACAAGTGTGCTAGGG - Intergenic
1193653396 X:84167788-84167810 GTATGTGTGTGTGTGTGCTGGGG + Intronic
1194139406 X:90191412-90191434 GTGTGTGTCTGTGTGTGGTGAGG + Intergenic
1194598695 X:95892557-95892579 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
1194766943 X:97852442-97852464 GTATGTGACCGTGTGTGGTGGGG + Intergenic
1194785013 X:98072567-98072589 GTGTGTGTGTGTGTGTGGTGTGG + Intergenic
1196047238 X:111269267-111269289 TTATGTGCACGTGTGTGCCTGGG - Intronic
1196427877 X:115590389-115590411 GTATGTGCATGTGTGTGAACAGG - Intronic
1196561986 X:117160503-117160525 ATATGTGTGTGTGTGTGGTGGGG - Intergenic
1196767820 X:119264641-119264663 ATATGTGCATGTGGGTGGGGAGG - Intergenic
1197631913 X:128870763-128870785 GTATGTGCATATATGTGTTGGGG - Intergenic
1197717156 X:129717979-129718001 GTGTGTGTGTGTGTGTGGTGAGG - Intergenic
1198480753 X:137037680-137037702 GAATGTGTGTGTGTGTGGTGGGG + Intergenic
1199334483 X:146602125-146602147 GTGTGTGTGTGTGTGTGGTGAGG + Intergenic
1199460143 X:148075161-148075183 GGATGTGGACGTCTTTGGTGGGG - Intergenic
1199498119 X:148476768-148476790 GTGTGTGTGTGTGTGTGGTGAGG - Intergenic
1199694970 X:150337424-150337446 GAATCTGCCCGTGTGTGGGGTGG - Intergenic
1199807408 X:151314072-151314094 GTATGTGTACGTGGGTGTGGTGG - Intergenic
1199880614 X:151971897-151971919 GTGTGTGTGTGTGTGTGGTGAGG + Intronic
1200022403 X:153223076-153223098 GTATGTGCATGTGAGTGTGGAGG - Intergenic
1201490877 Y:14540108-14540130 GTGTGTGTGTGTGTGTGGTGGGG + Intronic
1201705853 Y:16935962-16935984 GTGTGTGTACGTATGGGGTGAGG + Intergenic