ID: 1062934651

View in Genome Browser
Species Human (GRCh38)
Location 10:1376846-1376868
Sequence GGCTCAGCTTTGGTGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062934639_1062934651 9 Left 1062934639 10:1376814-1376836 CCCTTCCCACGTGTTTCCAGGTC 0: 1
1: 0
2: 2
3: 11
4: 136
Right 1062934651 10:1376846-1376868 GGCTCAGCTTTGGTGGGGCAGGG No data
1062934638_1062934651 10 Left 1062934638 10:1376813-1376835 CCCCTTCCCACGTGTTTCCAGGT 0: 1
1: 0
2: 1
3: 11
4: 156
Right 1062934651 10:1376846-1376868 GGCTCAGCTTTGGTGGGGCAGGG No data
1062934644_1062934651 -7 Left 1062934644 10:1376830-1376852 CCAGGTCCACACGTCAGGCTCAG 0: 1
1: 0
2: 1
3: 8
4: 113
Right 1062934651 10:1376846-1376868 GGCTCAGCTTTGGTGGGGCAGGG No data
1062934641_1062934651 4 Left 1062934641 10:1376819-1376841 CCCACGTGTTTCCAGGTCCACAC 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1062934651 10:1376846-1376868 GGCTCAGCTTTGGTGGGGCAGGG No data
1062934642_1062934651 3 Left 1062934642 10:1376820-1376842 CCACGTGTTTCCAGGTCCACACG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1062934651 10:1376846-1376868 GGCTCAGCTTTGGTGGGGCAGGG No data
1062934640_1062934651 8 Left 1062934640 10:1376815-1376837 CCTTCCCACGTGTTTCCAGGTCC 0: 1
1: 0
2: 1
3: 15
4: 160
Right 1062934651 10:1376846-1376868 GGCTCAGCTTTGGTGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062934651 Original CRISPR GGCTCAGCTTTGGTGGGGCA GGG Intronic
No off target data available for this crispr