ID: 1062936556

View in Genome Browser
Species Human (GRCh38)
Location 10:1394896-1394918
Sequence AAGAAGAAGGAGGAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7281
Summary {0: 4, 1: 62, 2: 303, 3: 1376, 4: 5536}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062936556_1062936563 24 Left 1062936556 10:1394896-1394918 CCTCCCTCCTCCTCCTTCTTCTT 0: 4
1: 62
2: 303
3: 1376
4: 5536
Right 1062936563 10:1394943-1394965 CAAGATCTTGCTCTGTCCCCAGG 0: 2
1: 16
2: 138
3: 900
4: 4058
1062936556_1062936564 28 Left 1062936556 10:1394896-1394918 CCTCCCTCCTCCTCCTTCTTCTT 0: 4
1: 62
2: 303
3: 1376
4: 5536
Right 1062936564 10:1394947-1394969 ATCTTGCTCTGTCCCCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062936556 Original CRISPR AAGAAGAAGGAGGAGGAGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr