ID: 1062937566

View in Genome Browser
Species Human (GRCh38)
Location 10:1399738-1399760
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062937563_1062937566 -6 Left 1062937563 10:1399721-1399743 CCAGCTTGTCACTGAGTGTGCCA 0: 1
1: 0
2: 0
3: 12
4: 136
Right 1062937566 10:1399738-1399760 GTGCCAGGGAACCACTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr