ID: 1062939033

View in Genome Browser
Species Human (GRCh38)
Location 10:1408013-1408035
Sequence CAGTGTGAGCCCTTGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062939033_1062939036 21 Left 1062939033 10:1408013-1408035 CCACCTTCCAAGGGCTCACACTG No data
Right 1062939036 10:1408057-1408079 TTATACTGTCTTAGCTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062939033 Original CRISPR CAGTGTGAGCCCTTGGAAGG TGG (reversed) Intronic
No off target data available for this crispr