ID: 1062939825

View in Genome Browser
Species Human (GRCh38)
Location 10:1412944-1412966
Sequence CCCCTCTCCATTAGGGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 161}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062939825_1062939843 17 Left 1062939825 10:1412944-1412966 CCGCCCACCCTAATGGAGAGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
Right 1062939843 10:1412984-1413006 GGGCTGGCGGGAGGGTGGATGGG No data
1062939825_1062939838 8 Left 1062939825 10:1412944-1412966 CCGCCCACCCTAATGGAGAGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
Right 1062939838 10:1412975-1412997 ACTGCCTCAGGGCTGGCGGGAGG No data
1062939825_1062939833 1 Left 1062939825 10:1412944-1412966 CCGCCCACCCTAATGGAGAGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
Right 1062939833 10:1412968-1412990 CTTGCCCACTGCCTCAGGGCTGG No data
1062939825_1062939839 9 Left 1062939825 10:1412944-1412966 CCGCCCACCCTAATGGAGAGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
Right 1062939839 10:1412976-1412998 CTGCCTCAGGGCTGGCGGGAGGG No data
1062939825_1062939844 24 Left 1062939825 10:1412944-1412966 CCGCCCACCCTAATGGAGAGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
Right 1062939844 10:1412991-1413013 CGGGAGGGTGGATGGGCCCTCGG No data
1062939825_1062939834 4 Left 1062939825 10:1412944-1412966 CCGCCCACCCTAATGGAGAGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
Right 1062939834 10:1412971-1412993 GCCCACTGCCTCAGGGCTGGCGG No data
1062939825_1062939836 5 Left 1062939825 10:1412944-1412966 CCGCCCACCCTAATGGAGAGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
Right 1062939836 10:1412972-1412994 CCCACTGCCTCAGGGCTGGCGGG No data
1062939825_1062939831 -4 Left 1062939825 10:1412944-1412966 CCGCCCACCCTAATGGAGAGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
Right 1062939831 10:1412963-1412985 GGGGTCTTGCCCACTGCCTCAGG No data
1062939825_1062939845 25 Left 1062939825 10:1412944-1412966 CCGCCCACCCTAATGGAGAGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
Right 1062939845 10:1412992-1413014 GGGAGGGTGGATGGGCCCTCGGG No data
1062939825_1062939841 12 Left 1062939825 10:1412944-1412966 CCGCCCACCCTAATGGAGAGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
Right 1062939841 10:1412979-1413001 CCTCAGGGCTGGCGGGAGGGTGG No data
1062939825_1062939842 16 Left 1062939825 10:1412944-1412966 CCGCCCACCCTAATGGAGAGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
Right 1062939842 10:1412983-1413005 AGGGCTGGCGGGAGGGTGGATGG No data
1062939825_1062939832 -3 Left 1062939825 10:1412944-1412966 CCGCCCACCCTAATGGAGAGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
Right 1062939832 10:1412964-1412986 GGGTCTTGCCCACTGCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062939825 Original CRISPR CCCCTCTCCATTAGGGTGGG CGG (reversed) Intronic
900468329 1:2836794-2836816 CCCCTCTGCAGTGGGCTGGGAGG - Intergenic
900922406 1:5681754-5681776 CCCTTCCCCTTGAGGGTGGGTGG - Intergenic
900991554 1:6100494-6100516 ACCCTCGCCATCAGGGAGGGTGG + Exonic
902036071 1:13459070-13459092 CCCCTCCCCTTGAGTGTGGGTGG - Intergenic
905111068 1:35594978-35595000 GCCCTTTCCATTAGCGTGGCTGG + Exonic
908469718 1:64431786-64431808 CCACTTTCCCTTAGGGAGGGTGG + Intergenic
912580268 1:110714694-110714716 CCCCTCTCCAATACGGTGGATGG + Intergenic
916604383 1:166326465-166326487 CCCTTCTCCTTGAGGGTGGCTGG + Intergenic
920862880 1:209725139-209725161 CGCATCTCCAGTAGGGTTGGAGG - Intronic
922170275 1:223148748-223148770 CCCCTCTCCATTTTTGTGGGTGG + Intergenic
924324058 1:242877782-242877804 CCCCTCTCCTTAAGTGTGGGTGG - Intergenic
924674891 1:246165869-246165891 CCACTCTACATTAGGGTGAGAGG + Intronic
1062939825 10:1412944-1412966 CCCCTCTCCATTAGGGTGGGCGG - Intronic
1065813002 10:29459706-29459728 CTGCTCTCCTTTTGGGTGGGTGG + Intronic
1071905495 10:90169465-90169487 CCCCTCTTTTTTGGGGTGGGGGG + Intergenic
1074865138 10:117540510-117540532 CCTCTCTCAATTAGGCTGTGAGG - Intergenic
1075285774 10:121184549-121184571 CCCCTCTCCAAGAGGTAGGGAGG + Intergenic
1076453532 10:130573688-130573710 CCCCTGTCCATGAAGGTAGGAGG - Intergenic
1077110016 11:858212-858234 CACCTCTCCAAAGGGGTGGGTGG + Intronic
1077162030 11:1118127-1118149 CCCCTCCCCATGCAGGTGGGTGG - Intergenic
1078418606 11:11187918-11187940 TCCCTCTCAATTATAGTGGGGGG + Intergenic
1080608079 11:33881087-33881109 CCCATCTCCATTTGGGATGGTGG + Intronic
1086835275 11:91613418-91613440 CCCCTCTCTTTTAATGTGGGAGG + Intergenic
1088912121 11:114199491-114199513 CACATTTCCACTAGGGTGGGAGG - Intronic
1090856939 11:130618050-130618072 CCCCTCCCCTTTAGTGTGGGTGG + Intergenic
1091899630 12:4134450-4134472 CCCGTCCCCATGATGGTGGGTGG + Intergenic
1094090607 12:26644988-26645010 GCTGTCTCCATTAGGGTGAGGGG - Intronic
1096674694 12:53220180-53220202 CCCCGCTCCAGCAGGGGGGGAGG + Intronic
1098123934 12:67270108-67270130 CCCTTCTCCACAATGGTGGGTGG - Intronic
1101709009 12:107247731-107247753 CCCCTCTCCTTGAGTATGGGAGG + Intergenic
1108423048 13:50270483-50270505 TCCCTCTCAACTAGGGAGGGAGG + Intronic
1110198632 13:72821142-72821164 CAGATCTCCATTAGGGTTGGAGG + Intronic
1111103859 13:83621088-83621110 CCCTTGTGCAATAGGGTGGGAGG - Intergenic
1111761452 13:92471049-92471071 CCCCTCTCCATGCAGCTGGGAGG + Intronic
1112538821 13:100286069-100286091 CCCCTCTGCATGTGTGTGGGGGG + Intronic
1112786993 13:102961929-102961951 CCCCTCTCTATTGGGATGTGTGG + Intergenic
1113134957 13:107079156-107079178 CCCCTCTCCACTTTGGTGAGTGG - Intergenic
1114643168 14:24238224-24238246 CCCCCCTCCATGATGGTGGCAGG + Exonic
1117636904 14:57753760-57753782 TCCCTCTTCTTTAGGGTGGAGGG + Intronic
1117807287 14:59507681-59507703 CACCTCTCCAGGAGGGTGGTAGG + Intronic
1118669312 14:68105033-68105055 TCAATCTCCATTGGGGTGGGAGG - Intronic
1118881426 14:69829632-69829654 CCCCGCTCGGGTAGGGTGGGAGG + Intergenic
1119102358 14:71891604-71891626 CTCCTCCCCTTGAGGGTGGGTGG - Intergenic
1120549327 14:85849950-85849972 CCTCTCTCCTGTAGGGAGGGTGG + Intergenic
1123646068 15:22438176-22438198 CTCCCCTCTCTTAGGGTGGGTGG - Intergenic
1124017643 15:25891059-25891081 CCCATCTCCCTTGGGGTAGGGGG + Intergenic
1124299956 15:28533147-28533169 CTCCCCTCTCTTAGGGTGGGTGG - Intergenic
1128062850 15:64746245-64746267 CCACTATCCTTTGGGGTGGGTGG + Intronic
1129116867 15:73369336-73369358 CCCCTCTCCAGGAGGGTTGCGGG - Intergenic
1130401577 15:83560117-83560139 CCTCTCTCCTCTGGGGTGGGGGG - Intronic
1131136624 15:89941609-89941631 GCCCTCTCCATGAGTGTAGGTGG + Intergenic
1132152352 15:99471487-99471509 CCCTTCTACATTGGGGAGGGTGG - Intergenic
1133206875 16:4239304-4239326 CCCCTTGCCATTGGGGTGGCCGG + Intronic
1133220716 16:4318056-4318078 CCCCTCCCCATTGGTGAGGGAGG - Intronic
1135138279 16:19900839-19900861 CTTCTCTCCAGTAGGGTTGGTGG + Intergenic
1135284494 16:21181804-21181826 CCCCTCCTCATGAGAGTGGGTGG - Intergenic
1136511419 16:30740023-30740045 CCCCTTCCCCTAAGGGTGGGGGG - Exonic
1137651572 16:50124953-50124975 TCCCTCTCCTTCAGTGTGGGTGG - Intergenic
1138214583 16:55191938-55191960 CCCCTCTCCTGGAGGGTGGGAGG + Intergenic
1139465682 16:67152897-67152919 ACCCGCTCCATTATAGTGGGTGG + Intergenic
1141577152 16:84971389-84971411 CCCCTCTCCTTTGGGGTCTGGGG - Intergenic
1142155272 16:88530115-88530137 CCCCTCTCCATCCTGGTGGAGGG - Intronic
1142978583 17:3659010-3659032 CCCCAGTCCCTGAGGGTGGGAGG + Intronic
1143337683 17:6185529-6185551 CCCCTCCCCTTGAGTGTGGGTGG + Intergenic
1146218836 17:31000769-31000791 CCCCTCCCCTTCAGTGTGGGTGG - Intergenic
1146811377 17:35906585-35906607 CCCCTCTCCAATACAGTAGGAGG - Intergenic
1146935669 17:36811195-36811217 CCACACTCCATCAGGGTGGCTGG + Intergenic
1147421227 17:40323056-40323078 CCCCTCCCCACCAGGCTGGGGGG + Intronic
1147626176 17:41901650-41901672 CCCCTCACCCTGAGTGTGGGTGG - Intronic
1147774566 17:42891588-42891610 CCTCTCTTCTTTAGGGTGGAAGG - Intergenic
1151529103 17:74692991-74693013 CCCATCTCCACTAGGCTGTGTGG - Intronic
1152250956 17:79212322-79212344 CCCCTCCCCATTTGCCTGGGAGG + Intronic
1157031635 18:43917532-43917554 GCCCTCTTCATTAGGGAGAGTGG + Intergenic
1157843326 18:50979609-50979631 CCCCTCTCCTTGAGTGTGGCTGG - Intronic
1160309227 18:77773203-77773225 CACTTCTCTATGAGGGTGGGGGG - Intergenic
1160824774 19:1074501-1074523 CCCCTCTACATTAACGGGGGTGG + Intronic
1162989630 19:14293782-14293804 CCTCTCTCCCTTAGGATGGCTGG + Intergenic
1162994390 19:14324776-14324798 CCCACCTACATTAGGGAGGGTGG + Intergenic
1164641474 19:29829158-29829180 ACCCTCTCTAATACGGTGGGTGG - Intergenic
1166328767 19:42066927-42066949 CTTCTCCCCAGTAGGGTGGGGGG - Intronic
1166731369 19:45060828-45060850 CCCCAGTCCAGTAGGGTGAGGGG - Intronic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
1168695115 19:58399931-58399953 CCCCACTCCCCTAGGTTGGGTGG - Intergenic
925342238 2:3145680-3145702 CCCCTCTCCAGCAGGGTAGGTGG + Intergenic
926302068 2:11611702-11611724 CCCCTCTCCCAGATGGTGGGGGG + Intronic
940006831 2:149016157-149016179 CCCATCTTCATTAGAGTGGATGG + Intronic
941481901 2:166025582-166025604 CCCCACTCCATGAGTGTGGTTGG - Intronic
944896746 2:204173056-204173078 CCCTTCTGCATTAGGGAGAGTGG + Intergenic
946188783 2:217996342-217996364 CCCCTCACCCTTAGGCTGGGAGG + Intronic
947050977 2:226042761-226042783 CGCCTGTCCCTGAGGGTGGGAGG + Intergenic
947106202 2:226670249-226670271 CCCCTCTCCCTGACTGTGGGTGG - Intergenic
947688997 2:232117226-232117248 CACCTCTCCATCAGGGAAGGGGG + Intronic
948537478 2:238656953-238656975 TCCCTCTCTATTAGTGTGTGTGG + Intergenic
1170269249 20:14506000-14506022 ACCCTCTCCATTTGGTTGTGTGG + Intronic
1171036364 20:21715296-21715318 CCCCCCTCCATTAGGGCTGGTGG - Exonic
1173317848 20:41961181-41961203 TGCCTCTCCATGAAGGTGGGAGG + Intergenic
1175411929 20:58776237-58776259 CTTCACTCCATTTGGGTGGGTGG - Intergenic
1176011844 20:62901303-62901325 CACCTCTCCATTAAGTTGGAAGG - Intronic
1176556570 21:8256681-8256703 CCCCTCTCCTCTTGGGCGGGGGG + Intergenic
1176575509 21:8439723-8439745 CCCCTCTCCTCTTGGGCGGGGGG + Intergenic
1181363392 22:22355694-22355716 CCCCTGTTCATTAAGGTGGGAGG + Intergenic
1181366275 22:22379139-22379161 CCCCTGTTCATTAACGTGGGAGG + Intergenic
1182119164 22:27775735-27775757 CCTCTCTTCATTAGAGTCGGAGG - Intronic
1183228040 22:36563587-36563609 CTCCTCTCCGTTAGGGTGCCTGG - Intergenic
1183357785 22:37368755-37368777 CCCCTTTCCATGAGTGTGGATGG - Exonic
1184331084 22:43828346-43828368 CCCCTGTCCTTAAGGGTGTGTGG - Intronic
1185015946 22:48342688-48342710 CCCTTCCACATCAGGGTGGGTGG - Intergenic
1203253559 22_KI270733v1_random:128778-128800 CCCCTCTCCTCTTGGGCGGGGGG + Intergenic
1203261614 22_KI270733v1_random:173856-173878 CCCCTCTCCTCTTGGGCGGGGGG + Intergenic
949859955 3:8495958-8495980 TCCCTCTCCATTAGTATGGGTGG - Intergenic
950458337 3:13105808-13105830 CCCCTCTCCATGTGGGGAGGTGG + Intergenic
954306124 3:49726384-49726406 CCCCACTTCAGTGGGGTGGGAGG + Exonic
954781261 3:53063087-53063109 CCCGCCTCCACCAGGGTGGGTGG - Intronic
955556151 3:60139617-60139639 CCCCTGACTATGAGGGTGGGAGG + Intronic
961066958 3:123884077-123884099 CCCCTCTCCATTAGGGGAGTCGG + Intronic
966882836 3:184359721-184359743 AGCCTCTCACTTAGGGTGGGTGG + Intronic
968472436 4:788237-788259 CCCCCCTCCATTTGGGAGGAAGG - Intronic
968810715 4:2798585-2798607 CCCCTTTCCAGTGGGGTGAGTGG + Intronic
969948459 4:10808624-10808646 TCCCTCTCCTTTAAGCTGGGAGG + Intergenic
970151598 4:13095948-13095970 CTCCTCCCCAGTAGGGTGGATGG + Intergenic
971238834 4:24869141-24869163 CCCCTCTACATGGTGGTGGGAGG + Intronic
972840365 4:42923144-42923166 CACCCCTCCATAAGGGAGGGAGG + Intronic
972860965 4:43168974-43168996 CCCCTTTCCATGAGAGTGGATGG - Intergenic
975613584 4:76224373-76224395 CCTCTCTCCATTTCTGTGGGAGG - Intronic
981758364 4:148166609-148166631 CCCTTTTCCTTTAGGGTGGTAGG - Intronic
985106759 4:186507150-186507172 TCCCTCTCCTTGAGTGTGGGTGG - Intronic
985688110 5:1292883-1292905 CCCCTCTTCCTGGGGGTGGGAGG - Intronic
986664578 5:10089300-10089322 CCCCTCTCTTTGAGTGTGGGTGG - Intergenic
990915831 5:60905146-60905168 CCCCTCCCCACCAGGGTGGGTGG - Intronic
992760954 5:79950594-79950616 CCTCTCTCCAGTTGGGTGGAAGG - Intergenic
994212884 5:97105848-97105870 TCCCTTTCCATTTGGGTGTGGGG + Intronic
995473342 5:112525323-112525345 CCCCTCTCAATAAGGGAGGGCGG - Intergenic
997614868 5:135239394-135239416 CCCCTTCCCATGAGGCTGGGGGG - Intronic
1001661457 5:173396553-173396575 CCTCTCTCCACTAGGGGGTGGGG + Intergenic
1001761580 5:174212204-174212226 TCCCTCTCCATTAGGGGAGAGGG - Intronic
1002900573 6:1406705-1406727 CCCCTCTCCCACAGGGAGGGTGG + Intergenic
1003364232 6:5457250-5457272 CCCCTGACCATAGGGGTGGGAGG - Intronic
1003920057 6:10824594-10824616 CCCCTCTCCATACAGATGGGTGG + Intronic
1006813109 6:36833380-36833402 CCCCTCCCCTTGAGAGTGGGCGG + Intronic
1010274747 6:73956518-73956540 CTCCTCTCCCTTGGGGTGGAGGG - Intergenic
1010571036 6:77475017-77475039 CCTGTGGCCATTAGGGTGGGAGG - Intergenic
1011756843 6:90508841-90508863 TCCGTCCCCATTTGGGTGGGTGG - Intergenic
1016493911 6:144637705-144637727 CCAATGTCCATTAGGGTGGAGGG - Intronic
1017714024 6:157195616-157195638 CCCCTCCCCTTCAGTGTGGGTGG - Intronic
1019576085 7:1738247-1738269 CCTCTCTCCATCTGGGTGAGGGG + Intronic
1020051550 7:5085331-5085353 CCCCTCTACACTGGGCTGGGTGG + Intergenic
1023823753 7:43995048-43995070 CCCCTCTCCAGGACTGTGGGAGG - Intergenic
1024564611 7:50671180-50671202 CCCCTCTCCTTGAAGGTAGGAGG - Intronic
1024831426 7:53463817-53463839 CCTCTCTCCATTAGGAAGTGTGG + Intergenic
1027782236 7:82534201-82534223 CCCCTCCCCTTGAGTGTGGGTGG + Intergenic
1029551194 7:101237904-101237926 CCCCGCCCCACGAGGGTGGGGGG + Intronic
1029752020 7:102548461-102548483 CCCCTCTCCAGGACTGTGGGAGG - Intronic
1029769972 7:102647555-102647577 CCCCTCTCCAGGACTGTGGGAGG - Intronic
1034473794 7:151271029-151271051 CCCCTCTGCAGTGGGGTGGATGG - Intronic
1034529846 7:151688905-151688927 CCCCTCTCCTCCAGGGTGGCCGG + Intronic
1034900550 7:154905713-154905735 TCCCTCCCCATCTGGGTGGGTGG + Intergenic
1038532758 8:28331744-28331766 GCCCACTCCACTGGGGTGGGTGG - Intronic
1047714689 8:127584807-127584829 ACCCAGTTCATTAGGGTGGGTGG - Intergenic
1050855526 9:10349240-10349262 CCTGTCTCCAGTGGGGTGGGGGG + Intronic
1051149105 9:14061508-14061530 GCCATTTCCATTAGGGTGGGTGG - Intergenic
1051594541 9:18811232-18811254 CTCCCCTCCATGAGGGTTGGGGG - Intronic
1055289582 9:74768952-74768974 CCCCTTTCCTTAAGGGTTGGAGG + Intronic
1055305399 9:74924061-74924083 CCCAGCTCCATGGGGGTGGGGGG + Intergenic
1056034866 9:82593772-82593794 CCCCTTTCTAAGAGGGTGGGGGG + Intergenic
1203469960 Un_GL000220v1:111925-111947 CCCCTCTCCTCTTGGGCGGGGGG + Intergenic
1203477781 Un_GL000220v1:155897-155919 CCCCTCTCCTCTTGGGCGGGGGG + Intergenic
1186299397 X:8183101-8183123 ACCCTCACCAGCAGGGTGGGTGG + Intergenic
1186856326 X:13629743-13629765 CCCCATCCCATTAGGCTGGGGGG + Intronic
1188244034 X:27820144-27820166 CCCCTCTCTTTTGTGGTGGGTGG - Intronic
1190100900 X:47522444-47522466 GCACTCTCCATTAGGGTGCTGGG + Intergenic
1190882542 X:54502829-54502851 CCCCACTTCACTGGGGTGGGAGG - Intergenic
1192160827 X:68785938-68785960 TCCCTCTCCACCAGGGTGGGTGG + Intergenic
1192191155 X:68991940-68991962 CCCCTCCCCTATAGGGTGTGGGG + Intergenic
1194249514 X:91557335-91557357 ACCCACTCCAACAGGGTGGGTGG - Intergenic
1196752599 X:119131248-119131270 CCCCTCTCCTTCAGTGTGGGTGG + Intronic
1198043434 X:132876641-132876663 ACCCACTCCTTTATGGTGGGAGG + Intronic
1198731028 X:139729270-139729292 CCCTTCTCCTCTAGGCTGGGAGG + Intronic
1199590000 X:149458805-149458827 CACCTCTCAATGAGGTTGGGTGG - Intergenic
1200568472 Y:4798550-4798572 ACCCACTCCAACAGGGTGGGTGG - Intergenic