ID: 1062941629

View in Genome Browser
Species Human (GRCh38)
Location 10:1426249-1426271
Sequence CAGTGCCAGCCTCATTAGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062941627_1062941629 7 Left 1062941627 10:1426219-1426241 CCAAGCAATGCAGCACACAGATG 0: 1
1: 0
2: 2
3: 30
4: 310
Right 1062941629 10:1426249-1426271 CAGTGCCAGCCTCATTAGGTCGG No data
1062941625_1062941629 25 Left 1062941625 10:1426201-1426223 CCCTGGTGAGAGGTGAGGCCAAG 0: 1
1: 0
2: 2
3: 31
4: 263
Right 1062941629 10:1426249-1426271 CAGTGCCAGCCTCATTAGGTCGG No data
1062941626_1062941629 24 Left 1062941626 10:1426202-1426224 CCTGGTGAGAGGTGAGGCCAAGC 0: 1
1: 0
2: 1
3: 19
4: 252
Right 1062941629 10:1426249-1426271 CAGTGCCAGCCTCATTAGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062941629 Original CRISPR CAGTGCCAGCCTCATTAGGT CGG Intronic
No off target data available for this crispr