ID: 1062944255

View in Genome Browser
Species Human (GRCh38)
Location 10:1448753-1448775
Sequence CTGTTGATTTAGACCAAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062944255_1062944257 5 Left 1062944255 10:1448753-1448775 CCGTGCTTGGTCTAAATCAACAG 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1062944257 10:1448781-1448803 CTTTGTCGACCTAGCACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062944255 Original CRISPR CTGTTGATTTAGACCAAGCA CGG (reversed) Intronic
901104977 1:6748163-6748185 CTGTTTATATAGACAAAGCTTGG - Intergenic
909430067 1:75577174-75577196 CTGTTGAAATAGCCCAAGCAAGG - Intronic
912824399 1:112892577-112892599 CACTTGATTTAGGCCAGGCACGG + Intergenic
920811902 1:209293763-209293785 GTGTTGAGAAAGACCAAGCACGG + Intergenic
921967331 1:221104333-221104355 ATGTGGATTTAGCCCAAGAATGG - Intergenic
924861522 1:247928641-247928663 GTGTTGATTTTGGCCAATCAGGG + Intergenic
1062944255 10:1448753-1448775 CTGTTGATTTAGACCAAGCACGG - Intronic
1063459197 10:6204467-6204489 CCGGTGATTCAGACCGAGCAGGG - Intronic
1067283200 10:44888489-44888511 TTGTTGTTTTTGCCCAAGCAAGG + Intergenic
1067295400 10:44972692-44972714 ATGTTGAATTAGACCAAGATAGG - Intronic
1070954024 10:80453300-80453322 CTGTTGAGTAACACCAAACAGGG - Intergenic
1081103770 11:39038431-39038453 CTGTTTATGTAGAGCAAGGATGG + Intergenic
1084673985 11:70623818-70623840 GAGTTGCTTTAGACCAAGGAAGG + Intronic
1085903060 11:80725110-80725132 CTATTGATATACACAAAGCATGG - Intergenic
1091597286 12:1886622-1886644 CTTTTGATTTAGACCAACCGGGG + Intronic
1097115215 12:56692000-56692022 CTTATGTTTTAGGCCAAGCATGG + Intergenic
1097555526 12:61132953-61132975 CAGTTTCTTTAGACAAAGCAGGG - Intergenic
1098695233 12:73544550-73544572 CTATTGACTTAGAACAAGGAAGG - Intergenic
1100019639 12:90053449-90053471 CTGTTAATTTAGTCCACACAGGG + Intergenic
1106780990 13:33058727-33058749 CTGTTGTTTTGGAACAATCACGG + Intronic
1107035701 13:35900533-35900555 ATGTTTATTTAGGCCCAGCATGG - Intronic
1109745575 13:66619105-66619127 CTATTGATATAAAACAAGCAAGG - Intronic
1110549283 13:76793711-76793733 ATGTACATTTAGACCAAGAAGGG - Intergenic
1110741466 13:79002246-79002268 CTGGTGATTTAGACAAGGCAGGG + Intergenic
1111287195 13:86110071-86110093 CTGTAGATTTACACCAGGAATGG + Intergenic
1111744473 13:92249483-92249505 CTGCTTATCTGGACCAAGCAGGG - Intronic
1112839046 13:103552933-103552955 CTGTGGATATAGGCCAGGCATGG + Intergenic
1113954599 13:114090738-114090760 CTGTGAATTTAGAGGAAGCAAGG - Intronic
1116253892 14:42524808-42524830 CTGATGATTCAAAACAAGCAGGG - Intergenic
1116891132 14:50269641-50269663 CTGTTTATTAGGACCTAGCAGGG + Intronic
1117592044 14:57280557-57280579 ATGAAGATTTAGACCAGGCACGG + Intronic
1122164037 14:99807703-99807725 CTGTTGATGCAGCCCACGCAGGG + Intronic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1126326089 15:47479148-47479170 CTGTTGACCAAGACCAAGCAAGG - Intronic
1131551788 15:93363692-93363714 ATCATGATTTAGACCAAACAGGG + Intergenic
1134368123 16:13598207-13598229 GTGGTGATGTAGACCAAGGATGG - Intergenic
1138227177 16:55305973-55305995 CTGGAGATCTAGACCAAGCTTGG - Intergenic
1141052828 16:80787506-80787528 CTGTTGATTTTAACCAAGAGAGG - Intronic
1142735736 17:1898030-1898052 CTGTTTATTAAAACAAAGCAAGG - Exonic
1146714712 17:35075703-35075725 GTGTTGATTTGGAGCAGGCAGGG - Intronic
1146802461 17:35837445-35837467 CTGTGAATTTAGGCCAGGCATGG - Intronic
1149812720 17:59693074-59693096 CATGTCATTTAGACCAAGCATGG + Intronic
1161889054 19:7020504-7020526 CAATTGATTTAGAGCAAGAAAGG - Intergenic
1161892399 19:7050245-7050267 CAATTGATTTAGAGCAAGAAAGG + Intronic
1163510345 19:17731183-17731205 CTGTTGGATTTGACCAGGCATGG - Intronic
1164989498 19:32674338-32674360 CTGAGGATTTAGAGCATGCAGGG - Intronic
1165373153 19:35422797-35422819 CTTTGGATTTACACCCAGCAGGG + Intergenic
1202633706 1_KI270706v1_random:23689-23711 CTTTTGCTTTAGACCAGTCATGG + Intergenic
1202652173 1_KI270707v1_random:16365-16387 CTTTTGCTTTAGACCATTCATGG - Intergenic
1202659964 1_KI270708v1_random:59365-59387 CTTTTGCTTTAGACCATTCATGG + Intergenic
925064828 2:921797-921819 CTGTTGTTTCAACCCAAGCATGG - Intergenic
925937087 2:8774443-8774465 CTGTTGAGTAAAACAAAGCAGGG + Intronic
927817441 2:26231674-26231696 CTGTGGAATTAGGCCAGGCATGG + Intronic
929756717 2:44772087-44772109 CTGCTTATTTTGACCAAACATGG + Exonic
931507107 2:62941044-62941066 GTATTGATTCAGTCCAAGCATGG - Intronic
934075267 2:88423001-88423023 CTGATGATTTAGAAGAAGGACGG + Intergenic
940041076 2:149361529-149361551 CTGTTTATCTCGACCAAGAAAGG - Intronic
941833653 2:169991870-169991892 ATGTTGTTTTAGGCCAGGCACGG - Intronic
941885028 2:170519233-170519255 TTGCTGACTGAGACCAAGCATGG + Intronic
942442619 2:176051957-176051979 TTGTTGATGTAGGCCAGGCATGG + Intergenic
943470168 2:188285285-188285307 CTGTTGATGCAGAACCAGCATGG + Intergenic
943750698 2:191506719-191506741 CAGTTGGCTTAGACCAATCAAGG + Intergenic
945131269 2:206575410-206575432 CAGTTGATTTATACCCAGTATGG + Intronic
1169300962 20:4441575-4441597 CTGTTGATTTATGCCATTCAGGG + Intergenic
1172309815 20:33908844-33908866 TTGTTGATTTAGGGCATGCAAGG - Intergenic
1172965247 20:38829771-38829793 TTCTTTAATTAGACCAAGCAGGG + Intronic
1174823413 20:53746960-53746982 CTCTTGGCTTAGACCAATCATGG + Intergenic
1175463485 20:59172806-59172828 CTGTGGGTTTATACCAAGGAGGG - Intergenic
1176599979 21:8783289-8783311 CTTTTGCTTTAGACCATTCATGG + Intergenic
1176645922 21:9349546-9349568 CTTTTGCTTTAGACCATTCATGG + Intergenic
1179336599 21:40462449-40462471 CTCTTGGTTTAGACTGAGCAAGG + Intronic
1180327438 22:11442927-11442949 CTTTTGCTTTAGACCATTCATGG + Intergenic
1180367004 22:11949607-11949629 CTTTTGCTTTAGACCATTCATGG - Intergenic
1180379081 22:12121744-12121766 CTTTTGCTTTAGACCATTCATGG + Intergenic
1180418443 22:12791572-12791594 CTTTTGCTTTAGACCATTCATGG - Intergenic
1182189847 22:28447498-28447520 CTGCTGATTTAAACCACTCAAGG + Intronic
951055841 3:18145524-18145546 CTGTTGGCTTAGACCAGGCATGG + Intronic
952555637 3:34527076-34527098 GTGTTGATTTGGACCCAGTAAGG - Intergenic
952822872 3:37499897-37499919 CTGATGATTTAGACTAACCCAGG - Intronic
953059565 3:39416011-39416033 CTGTTGTCTTTGACCAAGCAGGG - Intergenic
953266643 3:41395979-41396001 CTGTTGATTTTGACCAAGTTGGG + Intronic
955806399 3:62740078-62740100 CTGTTGACCTAGACTGAGCATGG + Intronic
956386870 3:68728840-68728862 ATGTTGAGACAGACCAAGCATGG - Intergenic
957094270 3:75763899-75763921 CTGTTGCTTTAGACCATTAATGG - Intronic
957348945 3:78998110-78998132 CTATTGATTTAGAAAAACCATGG - Intronic
957849955 3:85794859-85794881 ATGTTGATTCATACAAAGCAAGG + Intronic
959625406 3:108444199-108444221 ATGTTGATTTGGACCCAGGAAGG + Intronic
962128052 3:132643481-132643503 CTGTTGATGCAGGCCAAGTAAGG + Intronic
963702959 3:148649383-148649405 CTGTTGATTTAAATTAAGAATGG - Intergenic
966665409 3:182465667-182465689 CTGTTGTTTTATACACAGCAGGG - Intergenic
967238060 3:187407289-187407311 CTCTTGATGTAGACAAAGCCAGG - Intergenic
1202740963 3_GL000221v1_random:55517-55539 CTTTTGCTTTAGACCATTCATGG - Intergenic
969672266 4:8596351-8596373 TTGTTGATTTAACCTAAGCATGG + Intronic
969933909 4:10662313-10662335 CAGGGGATTTAGATCAAGCATGG - Intronic
970675032 4:18439269-18439291 CTTTTCATTTAGAGCAAGGAGGG - Intergenic
972026580 4:34386253-34386275 CTGTGGATTTAGAGCATGGATGG + Intergenic
973363343 4:49185707-49185729 CTTTTGCTTTAGACCATTCATGG + Intergenic
975830681 4:78365312-78365334 CAGTTGATATACACAAAGCAAGG - Intronic
977059592 4:92240587-92240609 CTGTTCATTCAGACACAGCAGGG - Intergenic
978891997 4:113840850-113840872 CTGTTGTTTTAGAATAAGGAGGG + Intergenic
979359625 4:119746450-119746472 CTGTATATTTAGGCCAGGCACGG + Intergenic
980705966 4:136495261-136495283 CTGTCAAATTAGGCCAAGCATGG - Intergenic
980854218 4:138419787-138419809 CTGTTGTTTTAAGCCAGGCATGG - Intergenic
982654534 4:158130964-158130986 CTGTGGATTCAGACCTCGCAAGG - Exonic
1202760699 4_GL000008v2_random:107224-107246 CTTTTGCTTTAGACCATTCATGG + Intergenic
986618425 5:9644286-9644308 CTGTTGCAGTAGACCAGGCAAGG + Intronic
987575045 5:19715438-19715460 CTGTTGTTTCAGACAGAGCATGG + Intronic
989007657 5:36833171-36833193 CTCTTCATTTAGACCAATTATGG - Intergenic
990696953 5:58429097-58429119 CTGTAAATTAAGACCTAGCATGG + Intergenic
991907456 5:71526324-71526346 TTTTTGATTTGGACCAGGCATGG + Intronic
992617076 5:78555234-78555256 GTTTTGATTTAAACCAAGCAAGG + Intronic
994593724 5:101805825-101805847 CTGTAGTTTTATTCCAAGCAAGG - Intergenic
999137736 5:149333836-149333858 TTGGTAATTTAGACCAACCAGGG - Intronic
1000245396 5:159444739-159444761 CTGTGGATTTAAACCAAAAAGGG + Intergenic
1001669975 5:173465763-173465785 CTGCAGCTTTAGACCAAGAAAGG - Intergenic
1004373576 6:15073378-15073400 CAGTTGACTCAGACCAACCAAGG - Intergenic
1005122540 6:22405567-22405589 CTGTTGGTTTAGATCAATAAGGG + Intergenic
1008168098 6:48166070-48166092 CTCTTGAAATAGACCAAGAAAGG - Intergenic
1012261913 6:97097279-97097301 CTGTTGATTGAAAACAATCAAGG + Intronic
1017425413 6:154315639-154315661 CTGTGGATCTATACCAAGCTTGG + Intronic
1022313827 7:29225225-29225247 CTCTTGATTTAGACAAATTATGG - Intronic
1026393696 7:69928858-69928880 CTGTTCACTTAGAACCAGCAAGG - Intronic
1026779933 7:73258990-73259012 ATGTGGATTTAGCCCAGGCATGG + Intergenic
1026966042 7:74440775-74440797 GTGTTAATTTAGGCCAAGCGCGG - Intergenic
1027020787 7:74812408-74812430 ATGTGGATTTAGCCCAGGCATGG + Intronic
1027067237 7:75133521-75133543 ATGTGGATTTAGCCCAGGCATGG - Intronic
1027287539 7:76663365-76663387 TTGCAGATTTAGACCAGGCACGG + Intergenic
1028340353 7:89711828-89711850 CTGCTGCTTTAGACATAGCATGG + Intergenic
1028962581 7:96765971-96765993 CTTTTGGCTTAAACCAAGCATGG - Intergenic
1030301511 7:107979086-107979108 CTGTTGATTCAGGCCCAGTAGGG - Intronic
1030641986 7:112016356-112016378 CTGATGAGATACACCAAGCAGGG - Intronic
1032459237 7:132097336-132097358 AGGTTGATTTAGACCCAGCAAGG + Intergenic
1036596927 8:10221711-10221733 CTGTTGATTAAAATAAAGCAGGG + Intronic
1037422378 8:18716741-18716763 CTATTGATGTAAATCAAGCATGG - Intronic
1038228348 8:25677516-25677538 CTGTTGTTGTATAGCAAGCAGGG + Intergenic
1038774887 8:30520061-30520083 CTCTTAGTTTACACCAAGCATGG - Intronic
1039912719 8:41837579-41837601 GTGTTGATTTAGGCCAGGCATGG + Intronic
1048550435 8:135428309-135428331 CTGATGAGTTTGACCCAGCATGG + Intergenic
1049267997 8:141679720-141679742 CTGAAGAGTTAGACCAACCACGG - Intergenic
1050315524 9:4397518-4397540 CTGTTGAAGAAAACCAAGCAAGG + Intergenic
1053650677 9:40165711-40165733 CTTTTGAATTAGAAAAAGCAAGG - Intergenic
1053755060 9:41298212-41298234 CTTTTGAATTAGAAAAAGCAAGG + Intergenic
1054331186 9:63757483-63757505 CTTTTGAATTAGAAAAAGCAAGG - Intergenic
1054533905 9:66210491-66210513 CTTTTGAATTAGAAAAAGCAAGG + Intergenic
1055896448 9:81181884-81181906 CTGTTCATCTGGAACAAGCATGG + Intergenic
1057477724 9:95417914-95417936 GTGTAGATTTAGACCAAGGTTGG + Intergenic
1059128806 9:111722458-111722480 CTGTTATTTTTGACCAAACAAGG - Exonic
1059388648 9:113984945-113984967 CTGTGGAGTTAGACCAACCAGGG - Intronic
1203750904 Un_GL000218v1:79343-79365 CTTTTGCTTTAGACCATTCATGG - Intergenic
1203483081 Un_GL000224v1:25002-25024 CTTTTGCTTTAGACCACTCATGG + Intergenic
1203709602 Un_KI270742v1:85447-85469 CTTTTGCTTTAGACCATTCATGG - Intergenic
1203541470 Un_KI270743v1:92109-92131 CTTTTGCTTTAGACCATTCATGG + Intergenic
1187430080 X:19214580-19214602 CTGATGACTAAGAGCAAGCAGGG - Intergenic
1191943095 X:66500889-66500911 CTGTTACTTTAGACCAAAGAAGG + Intergenic
1193756100 X:85410115-85410137 TGTTTAATTTAGACCAAGCATGG - Intergenic
1200060400 X:153481319-153481341 CTGTTGCTTGTGACCCAGCAGGG + Intronic
1201164560 Y:11196967-11196989 CTTTTGCTTTAGACCATTCATGG - Intergenic