ID: 1062949042

View in Genome Browser
Species Human (GRCh38)
Location 10:1482807-1482829
Sequence CCTAGAACACAGATGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062949042_1062949049 -6 Left 1062949042 10:1482807-1482829 CCTTCTTCCATCTGTGTTCTAGG 0: 1
1: 0
2: 0
3: 24
4: 273
Right 1062949049 10:1482824-1482846 TCTAGGTTTCTCGGGGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062949042 Original CRISPR CCTAGAACACAGATGGAAGA AGG (reversed) Intronic
900333044 1:2146091-2146113 CCGAGGAGACAGATGGAAGTAGG + Exonic
900965331 1:5953432-5953454 CAAAGAACACAGATTGGAGAAGG + Intronic
901148422 1:7084274-7084296 TCTTGAAGACAGATGGAGGACGG + Intronic
902951140 1:19883414-19883436 CCAGGAACATGGATGGAAGAAGG + Intronic
903296705 1:22348303-22348325 TCTCGAACACAGCGGGAAGAGGG + Intergenic
903393515 1:22981943-22981965 CCTAGCAAACAGATAGCAGATGG - Intergenic
904866376 1:33582180-33582202 CCTAGAACACAGAGGCCAGGTGG + Intronic
906821230 1:48932256-48932278 CATAGACCACAGGTTGAAGAAGG + Intronic
906824173 1:48961152-48961174 CCTAGAACACTGCAGGAACATGG + Intronic
908088321 1:60660456-60660478 CATAGAAAAGAGATTGAAGATGG + Intergenic
908961347 1:69700081-69700103 CCTAGATCACTGATTTAAGAGGG - Intronic
911636295 1:100239474-100239496 CATAGAAAAAACATGGAAGATGG + Intronic
912450300 1:109764131-109764153 CCTAAAAGGCAGAGGGAAGAGGG - Intronic
918250694 1:182700288-182700310 CCTAGAAAATGGATGGAAGCAGG + Intergenic
919813075 1:201421152-201421174 CAAAGAACACAGAAGCAAGATGG + Intronic
920049470 1:203154620-203154642 CCTAGTACACAGCTGGGACAGGG + Intronic
921485264 1:215708066-215708088 CCCAGAAGACAGTGGGAAGAAGG + Intronic
922429134 1:225529694-225529716 CCCAGAACACATACTGAAGACGG + Intronic
922565590 1:226599472-226599494 CCTAGAAGACAGTTGGATAAGGG + Intronic
923513107 1:234670444-234670466 CCTAGAACACAGATTCAGCAGGG + Intergenic
1062949042 10:1482807-1482829 CCTAGAACACAGATGGAAGAAGG - Intronic
1063356578 10:5405252-5405274 CATAGGACACAGATGTAAAAAGG - Intergenic
1063380835 10:5584667-5584689 CTTAGAACACAGACGCAAGCGGG + Intergenic
1063818555 10:9807309-9807331 CCTGGAACACAGATGAGTGATGG + Intergenic
1063914554 10:10868275-10868297 CCTGGATCAGAGATGCAAGATGG + Intergenic
1064485893 10:15789484-15789506 CCAAGAAAACAAATAGAAGAGGG - Intronic
1065853871 10:29814149-29814171 CCAAGTACACAGAGGGAAGGAGG - Intergenic
1066262834 10:33745765-33745787 CTCAGGAAACAGATGGAAGAGGG + Intergenic
1067177529 10:43960501-43960523 CCTAGAACAGAGAGGGCAGAGGG + Intergenic
1067934045 10:50593051-50593073 CCGAAAACAGAGATGGAAGGTGG - Intronic
1068818816 10:61349358-61349380 CTTGGAACACATTTGGAAGATGG + Intergenic
1068854898 10:61787560-61787582 CCTAAAACACATATCCAAGAGGG - Intergenic
1069918806 10:71803459-71803481 TCTAGGCCACAGCTGGAAGAAGG - Intronic
1071407168 10:85348338-85348360 CTGAGAAAACAGATGCAAGAAGG + Intergenic
1072574384 10:96686943-96686965 TCTAAAACACAGAGGGAAAAAGG - Intronic
1072634082 10:97166010-97166032 CCAAGGAGACAGATGGCAGAGGG - Intronic
1074782863 10:116814617-116814639 ACTAGGACACAGCTGGATGAGGG - Intergenic
1076613102 10:131738487-131738509 CCCAGAACGCAGCTGGAAGGAGG + Intergenic
1077890295 11:6413436-6413458 CTGAGAACACAGAGGGAAGGGGG - Intronic
1078776952 11:14402630-14402652 CCTGGAACATAGCAGGAAGATGG + Intergenic
1078848987 11:15146670-15146692 GCTAGAACACAGCAGGAACAAGG - Intronic
1079993800 11:27274223-27274245 CCTGGCACAAATATGGAAGAAGG + Intergenic
1080186521 11:29493846-29493868 CAAAGAAGACAGAAGGAAGAGGG - Intergenic
1080549666 11:33361570-33361592 CCTAGCACACTGATTGCAGATGG + Intergenic
1080637937 11:34139754-34139776 CCTAGAGCACAGATGTAAATCGG - Intronic
1081273338 11:41115500-41115522 GCTAAAACACACATTGAAGAAGG + Intronic
1083088363 11:60174249-60174271 CCAAGAACTCAGCTGGAAGATGG - Intronic
1083687765 11:64387241-64387263 CAAAGAACACAAATGAAAGATGG + Intergenic
1083758480 11:64803433-64803455 GCCAGAAGACAGAGGGAAGAGGG + Intergenic
1083857489 11:65400363-65400385 CCCAGGACACAGATGGCAGCAGG - Intronic
1084274610 11:68044946-68044968 CCTGGCACCCAGATGGAGGAGGG + Exonic
1085014292 11:73162794-73162816 CCCAGGGCACAAATGGAAGAAGG + Intergenic
1085408637 11:76278678-76278700 CCTTGAGCACTGATGGAGGATGG + Intergenic
1086595160 11:88561834-88561856 CCTAGAGCACAAATAGAAAAGGG - Intronic
1088756813 11:112891787-112891809 TCTGGATCACAGATGGAAGAAGG + Intergenic
1090641637 11:128734335-128734357 CTGAGTACTCAGATGGAAGAAGG + Intronic
1091388628 12:111446-111468 CCTAGAGAACAGAGGAAAGAGGG - Intronic
1091754572 12:3043084-3043106 GCCAGATCACAGATGGAAGACGG - Intergenic
1094148468 12:27255841-27255863 TCTAGAAGACAGATGGACAATGG - Intronic
1095144153 12:38704095-38704117 ACTAGAGGAGAGATGGAAGAAGG + Intronic
1095161420 12:38921083-38921105 GATAGAAGACAGATAGAAGATGG + Intergenic
1095478723 12:42611578-42611600 ACTAGAACAGGGAGGGAAGAGGG - Intergenic
1096004393 12:48157310-48157332 CTTAGAAGGCAGATCGAAGAGGG - Intronic
1098100619 12:67012404-67012426 CCTAGAACACTCCTGGAAGATGG - Intergenic
1098693782 12:73525622-73525644 ACTAGGACACAGAAGGAATATGG + Intergenic
1098823426 12:75262360-75262382 CCTAAATCAAGGATGGAAGAGGG + Intergenic
1098847010 12:75550186-75550208 CTTAGAATTTAGATGGAAGAGGG - Intergenic
1099104180 12:78479471-78479493 CCCAGAACAGAGACGGAGGAAGG + Intergenic
1099110094 12:78547881-78547903 CTCAGAACAGAGATGGGAGAAGG + Intergenic
1099903563 12:88743794-88743816 CCTAGAAGCCAGTTTGAAGATGG - Intergenic
1100591060 12:96030027-96030049 GCAAGAAGCCAGATGGAAGAAGG - Intronic
1101739015 12:107485363-107485385 CCTAGGACACAGCAGGAACAAGG - Intronic
1102084775 12:110126803-110126825 CCAATAACAGAAATGGAAGAAGG + Intronic
1103016173 12:117496193-117496215 CCTAGACCAGAGAGGGCAGAAGG - Intronic
1104008621 12:124913614-124913636 GCTGGAAAACAGCTGGAAGATGG - Exonic
1106459869 13:29959350-29959372 CCTGGAAAACAGTAGGAAGAAGG + Intergenic
1106681909 13:32017078-32017100 CCTAGAACATAGGAGTAAGATGG + Intergenic
1108980052 13:56499596-56499618 CCTAAAATACAAATGTAAGAAGG + Intergenic
1109459784 13:62641617-62641639 TCTAGTACATAGGTGGAAGATGG - Intergenic
1109492628 13:63122671-63122693 CTTAGAACACACATAGAAAATGG - Intergenic
1109614414 13:64811111-64811133 CCTAGAACACAAAAGGATGGGGG + Intergenic
1109758991 13:66801333-66801355 CCTAGAACACACAGGAAAAAAGG - Intronic
1110065272 13:71096706-71096728 CCTAAAGCACAGATTGAAGCAGG - Intergenic
1111121008 13:83849114-83849136 GATAGAACACAGAGGTAAGAGGG - Intergenic
1111220324 13:85196809-85196831 ACAAATACACAGATGGAAGATGG + Intergenic
1112861826 13:103838063-103838085 CCTAGAACACATTTTGAAAAGGG - Intergenic
1115953742 14:38752256-38752278 CCCAGACCACAAAGGGAAGATGG + Intergenic
1116030517 14:39565575-39565597 CCTAGAAAACAGAAGGCAGATGG - Intergenic
1116936681 14:50747706-50747728 CCTAGGCAACAGAGGGAAGAAGG + Intronic
1117319989 14:54612710-54612732 CCTAGCACGCAGATGGATGAGGG - Intronic
1117423235 14:55568951-55568973 CCTAGCAGACAGACAGAAGAAGG - Intronic
1120129990 14:80795322-80795344 CAGATAACACAGAAGGAAGAGGG - Intronic
1120144024 14:80959641-80959663 CCAAGACCACAGATGGCAGTGGG - Intronic
1121317711 14:92971942-92971964 CCTGGGACACTGATGGAACAAGG + Intronic
1122556442 14:102583294-102583316 CCTAGCACACGGAGGGGAGAAGG - Intergenic
1123963092 15:25427348-25427370 CCTATAAGATAGAAGGAAGATGG + Intronic
1125072154 15:35567826-35567848 AATATAACACAGATGGAATACGG - Intergenic
1126441696 15:48696768-48696790 CCTAGAAGGAAGATGGAAGCTGG - Intergenic
1127623106 15:60753286-60753308 CCTGTAACAGAGATGAAAGACGG - Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1129779439 15:78260418-78260440 CAGAGAGCACAGATGGATGAAGG - Intergenic
1130095348 15:80851418-80851440 CCTCGATCACAGATAGAAAAGGG + Intronic
1130399674 15:83537780-83537802 CCTAGAAGACAGAGAGCAGATGG - Intronic
1130733451 15:86523327-86523349 ACTTGGACACAGAGGGAAGATGG - Intronic
1131498253 15:92934067-92934089 CTTAGAAGACATCTGGAAGAGGG - Intronic
1131668289 15:94593156-94593178 CCTTGAATCCAGATGGATGATGG + Intergenic
1132874529 16:2130443-2130465 CCAAGGACAGAGATGGATGATGG - Intronic
1133717812 16:8466260-8466282 ACAAACACACAGATGGAAGATGG - Intergenic
1134553474 16:15149276-15149298 CCAAGGACAGAGATGGATGATGG - Intergenic
1135406081 16:22198869-22198891 CCTAGAACACTGTTGGCAGCAGG + Intergenic
1136628420 16:31475825-31475847 CCTGGAGCGCAGCTGGAAGACGG + Intronic
1137527644 16:49250167-49250189 CCTAGAGCACAAATGAAAGTAGG - Intergenic
1137703096 16:50512169-50512191 CCAAGAACACAAATGGGGGAAGG - Intergenic
1138695551 16:58809607-58809629 CCTGGAGAACAGATGGAAGGAGG - Intergenic
1139830603 16:69794604-69794626 CCTAGAAATCAGAAGTAAGATGG + Intronic
1140379278 16:74471671-74471693 ACTAGGAGACAGTTGGAAGAAGG + Intronic
1141930659 16:87200282-87200304 GCTAGGACAGACATGGAAGAAGG + Intronic
1142108573 16:88319165-88319187 CCTCACAGACAGATGGAAGAGGG + Intergenic
1142564508 17:831112-831134 CCTAGATCACAAATGGAAAAGGG + Intronic
1146930976 17:36777705-36777727 CGTAGAACACAAATGGGAGGGGG + Intergenic
1149814329 17:59707860-59707882 CCTAAAACACTGCTGGAAGTCGG - Intronic
1149984094 17:61334189-61334211 CCTTGAACACAGATGAGAGAGGG + Intronic
1150522529 17:65884058-65884080 CACAGAACACAGATGAGAGACGG + Intronic
1150976917 17:70097869-70097891 CCTAGGAAACAGATTCAAGAGGG - Intronic
1152557837 17:81063331-81063353 GCAAGAACACAGATGACAGATGG - Intronic
1153841551 18:9012392-9012414 CCTAGAAAACTGATGGAAACGGG + Intergenic
1155241981 18:23872666-23872688 GCTAGAAAAGAGATGGAGGAAGG - Intronic
1156614885 18:38771891-38771913 CCCACAACACAGAGGGATGATGG + Intergenic
1156929879 18:42628815-42628837 CATAGCAAACAGATTGAAGATGG + Intergenic
1157282636 18:46356224-46356246 CCTAGAACACACCTGGAACAGGG - Intronic
1157410552 18:47459444-47459466 CCTAGAACCGGGAAGGAAGAAGG + Intergenic
1157675206 18:49563371-49563393 CCCAGAACACAGAAGTTAGAAGG - Intronic
1158793170 18:60806955-60806977 CTAGGAACACAGATGGAAAATGG + Intergenic
1159148009 18:64480222-64480244 CCTAGAACACAGAAAGTGGATGG + Intergenic
1161294231 19:3511631-3511653 CCTAGAACCCACATGGCACATGG + Intronic
1167571344 19:50290822-50290844 CCTAGCACACAGAGGGAGGCTGG + Intronic
1167753871 19:51398300-51398322 GACAGAACACTGATGGAAGAAGG - Intergenic
926872543 2:17438880-17438902 CATAGAACACAGATGCCAGAGGG - Intergenic
927301141 2:21516618-21516640 TCCAGAAGACAGATGCAAGAAGG - Intergenic
929419810 2:41779092-41779114 CCAGGGAAACAGATGGAAGAGGG + Intergenic
931005027 2:57840324-57840346 CCTAGAACATGGATGGGAGGGGG - Intergenic
931865396 2:66404822-66404844 CCAAGTACACGTATGGAAGATGG + Intergenic
932577815 2:72972439-72972461 CCAAGATCTCAGATGGCAGAGGG - Intronic
933549088 2:83752054-83752076 ACTAGAAGAAATATGGAAGAAGG + Intergenic
933615548 2:84479148-84479170 CCCAGAACTCAGCTGGTAGAGGG - Intergenic
935207318 2:100907403-100907425 CCTTGTACTCAGATGGAAAAAGG + Intronic
935253101 2:101282856-101282878 TCTAGAACACAGGTGGAGCAGGG - Intronic
935664995 2:105503439-105503461 CCCTGAAAACACATGGAAGATGG - Intergenic
936102089 2:109590956-109590978 CCCAGAGCAGAGAAGGAAGATGG + Intronic
937299566 2:120830759-120830781 CCCAGAAAACAGAGGGAACATGG - Intronic
937733440 2:125261369-125261391 CCTAGGAAACAGAGGAAAGAAGG - Intergenic
939089699 2:137765216-137765238 CCTAGGAGAAAGAAGGAAGATGG - Intergenic
940662765 2:156568107-156568129 CCTTAAACTCAGAAGGAAGAAGG + Intronic
940819486 2:158336121-158336143 ACTAGAACAAAGAGGGGAGAAGG + Intronic
942320687 2:174733063-174733085 CATGGAACCCAGAGGGAAGACGG - Intergenic
943757175 2:191568937-191568959 CCTAGAACAAAGTTGAATGATGG - Intergenic
945052158 2:205834391-205834413 CCGAAAACACAGAGGGAAAAGGG - Intergenic
945899832 2:215525227-215525249 CTTATAACAAAGAGGGAAGAGGG + Intergenic
946138836 2:217670774-217670796 CCTAGAGCACAGGTGGTTGATGG + Intronic
947038562 2:225888199-225888221 GCTAGAACAAAGCTGGCAGAAGG + Intergenic
948077657 2:235178542-235178564 GCTAGCACACAGATGGATAATGG + Intergenic
948410824 2:237759244-237759266 ACTAGATTACAGGTGGAAGACGG + Intronic
1168840189 20:905089-905111 CCTAGAAGTCAGAAGGAAGCTGG - Intronic
1169537758 20:6564146-6564168 CATAGAACACAGTTGTAACAAGG - Intergenic
1169648657 20:7842659-7842681 CTTAGAAGACAGAAGAAAGAGGG - Intergenic
1170406145 20:16039584-16039606 CTTAGAACACAGAAGTAATAGGG - Intronic
1170571510 20:17635389-17635411 CCCAGAACCCAGACGGGAGATGG + Intronic
1170785998 20:19468177-19468199 ACTAGAGCACAGATATAAGATGG + Intronic
1171411825 20:24952840-24952862 CCTAGAACACTCCTGAAAGAGGG + Intronic
1173136687 20:40444937-40444959 CCTAGAAGACATGTGGAGGAAGG - Intergenic
1176177971 20:63737574-63737596 CCTAGAACCCAGAGGGCAGGAGG - Exonic
1176330603 21:5545771-5545793 TCTAGTACCCAGATGGAAGGGGG - Intergenic
1176397154 21:6275180-6275202 TCTAGTACCCAGATGGAAGGGGG + Intergenic
1176440003 21:6713924-6713946 TCTAGTACCCAGATGGAAGGGGG - Intergenic
1176464265 21:7040993-7041015 TCTAGTACCCAGATGGAAGGGGG - Intergenic
1176487826 21:7422772-7422794 TCTAGTACCCAGATGGAAGGGGG - Intergenic
1178284961 21:31317695-31317717 CCTAGAACCCAGGAGGCAGAGGG + Intronic
1178563597 21:33662305-33662327 CCTAGAAAATAGATGGAAAGAGG - Intronic
1178692602 21:34761855-34761877 CCTAGAGGACTGATGGAGGAGGG - Intergenic
1179089841 21:38255062-38255084 ACTGGAACACAGATGGTAAATGG + Intronic
1180223119 21:46372466-46372488 CCCAGAACACAGAAGCAGGAGGG - Intronic
1181021129 22:20103609-20103631 CCAAGAACACAGATGCAGCAGGG - Intronic
1184515792 22:44961409-44961431 CCTAGAGCAGAGAGGGAAGGAGG - Intronic
949458084 3:4260832-4260854 CCTAATCCCCAGATGGAAGAAGG + Intronic
950426557 3:12927630-12927652 CTCAGAGCACAGAGGGAAGAGGG + Intronic
951282590 3:20771100-20771122 CCCAGAAAACAAATGGAATATGG + Intergenic
952821793 3:37492304-37492326 CCTGGGACACACATGGAAGTCGG - Intronic
952871892 3:37908144-37908166 CCTAGAAACCACATGAAAGAAGG + Intronic
953503447 3:43460196-43460218 CCTAGAACCCAGATGGAGGCAGG + Intronic
954876696 3:53807073-53807095 CTGAGAACACAGGTGGAGGAGGG - Intronic
956977987 3:74604046-74604068 CCAAGAACACATAATGAAGAAGG + Intergenic
957106640 3:75897580-75897602 TCTAGAGAACAGATGGTAGAAGG + Intergenic
957234015 3:77561032-77561054 TCTATTACACAGAGGGAAGATGG - Intronic
957611671 3:82474499-82474521 CCTAAAACACAGATGAAAGGTGG + Intergenic
960177129 3:114531197-114531219 GCTGGAACACAGGAGGAAGAAGG - Intronic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
961395202 3:126582186-126582208 CTTACAACATAGATGGAAAATGG + Intronic
962701696 3:138007039-138007061 CCAAAAACATAGATTGAAGATGG - Intronic
962751325 3:138436327-138436349 ATTAGGACACAGAAGGAAGACGG - Intronic
963204753 3:142621370-142621392 CCTTGAACACAGAGGGTAGATGG - Intronic
963779239 3:149470481-149470503 ACAAGAGCAAAGATGGAAGATGG - Intergenic
964192429 3:154018786-154018808 CCATGAAAACAGTTGGAAGAGGG + Intergenic
964812868 3:160684351-160684373 CCCAGAACAGACAGGGAAGAGGG + Intergenic
964818022 3:160738230-160738252 CATAACACACAGATGTAAGATGG - Intergenic
964975032 3:162607580-162607602 GTTAAAACACAGAGGGAAGAAGG - Intergenic
965080702 3:164026909-164026931 ACTAGAAGAAAGGTGGAAGAAGG + Intergenic
965779260 3:172266897-172266919 TCTAGAACACAGATGCTGGAAGG - Intronic
966929784 3:184668876-184668898 CCCAGAGCACAGAGTGAAGATGG + Intronic
968681661 4:1925143-1925165 CCTAGGTTACAGATGGAAGCAGG - Intronic
970380276 4:15500620-15500642 TCTATCACACATATGGAAGAAGG + Intronic
971322663 4:25617900-25617922 ACAAGAACACAGATGGATGGGGG - Intergenic
971534574 4:27732820-27732842 CCTAGGACAAACATGAAAGAGGG + Intergenic
971969812 4:33606320-33606342 CCTAGAACAGAGTTGCTAGAGGG + Intergenic
972198051 4:36677939-36677961 CCTAGAAGACGGGAGGAAGATGG + Intergenic
973214043 4:47649021-47649043 CCTAGACCACAGTGGGAAGCAGG - Intronic
977526377 4:98151273-98151295 CCTAAGCCACAGTTGGAAGATGG - Intergenic
977623450 4:99163810-99163832 CCTAGATCTAAGATGGATGAGGG - Intergenic
979474020 4:121133811-121133833 ATTTGGACACAGATGGAAGATGG + Intronic
980040372 4:127932722-127932744 CATAAAACTCAGATGAAAGAGGG + Intronic
985616240 5:923439-923461 CCTAGAACCCAGGTGGAAGGAGG + Intergenic
989112745 5:37922969-37922991 CTGAGAACTCAGAAGGAAGAAGG - Intergenic
990486252 5:56261720-56261742 ACTAGAACACAGGTTGTAGAGGG - Intergenic
990920990 5:60966617-60966639 CCAAGAACACAGATGGGAAGAGG - Intronic
992695053 5:79277791-79277813 CCTAAAACACAGAAGCAAGAGGG - Intronic
992799826 5:80286081-80286103 CCAAGAACATACATGGAAAAAGG + Intergenic
992857397 5:80876680-80876702 ACTAGAGCACAGAAGGAATAAGG + Intergenic
994285555 5:97961015-97961037 CTTAGAATACATATAGAAGATGG - Intergenic
994723664 5:103409592-103409614 AGTAGAAAACAGATGGAAAAAGG + Intergenic
994988452 5:106967802-106967824 CTCAGAAAACAGATGGAATATGG + Intergenic
995163460 5:109009332-109009354 CCTATTAAAAAGATGGAAGAGGG - Intronic
995264326 5:110139851-110139873 CCAAGAACACAGATGGAGTTCGG + Intergenic
995402713 5:111759814-111759836 CCTACAGGATAGATGGAAGAGGG - Intronic
997532217 5:134588623-134588645 CCTGGAACACAGTGGAAAGAGGG - Intergenic
1001557610 5:172647233-172647255 CTTAGAGCAGAGAGGGAAGAGGG + Intronic
1001704608 5:173732869-173732891 CCTGGAACCCAGATCGGAGAGGG - Intergenic
1002401157 5:178992194-178992216 CCTGGGACACAGATGGGAGATGG + Intronic
1003917811 6:10804005-10804027 CCTGACACACAGATGGAACAGGG - Intronic
1004407895 6:15351611-15351633 CCCAGAACACAGGTGCAAGTCGG - Intronic
1004844052 6:19619091-19619113 CTTATAACAAAGATGCAAGAAGG + Intergenic
1004895113 6:20140703-20140725 TCTAGCTCACAGATGGCAGATGG + Intronic
1005827091 6:29639411-29639433 GCTAGATCGCAGATGGCAGATGG - Intergenic
1007163256 6:39810022-39810044 CCTGGAATGCAGATTGAAGATGG - Intronic
1007904143 6:45442432-45442454 CCAAGTCCACAGATGGAACAAGG - Intronic
1009904984 6:69859279-69859301 CATAGAGCACAGATATAAGAGGG - Intergenic
1010803275 6:80202894-80202916 TCTAGAAAACAGATGGAAAGAGG - Intronic
1011117479 6:83909541-83909563 CCTAGCTCTGAGATGGAAGAGGG + Intronic
1012673086 6:102080573-102080595 ACAAGAACACAGGTTGAAGAAGG - Intergenic
1014691888 6:124572162-124572184 AATAGAACAAAGATGGAGGAAGG - Intronic
1014927833 6:127295912-127295934 ACTGGAACACAGAAGGCAGAAGG + Intronic
1016086971 6:139926367-139926389 CACAAAACGCAGATGGAAGAGGG - Intergenic
1020260735 7:6529497-6529519 CCAACTGCACAGATGGAAGAAGG + Intronic
1020851062 7:13352827-13352849 CCTCGAAAACTGGTGGAAGAAGG - Intergenic
1021234541 7:18125999-18126021 CCTAGATGAAAGAAGGAAGAAGG - Intronic
1021316075 7:19148753-19148775 CCTAGAACACAGAGGAATCAAGG - Intergenic
1022109260 7:27218278-27218300 CATAGAACACAAATGAAGGATGG + Intergenic
1023823126 7:43991098-43991120 TCTAGCACACACAGGGAAGAGGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1025846180 7:65200295-65200317 CCTAGAGCCCAGAAGGAAGCTGG + Intergenic
1025961245 7:66223936-66223958 CCTAGAACACAAATGGAGACAGG - Intronic
1026297888 7:69071397-69071419 CCATGGACACAGATGGAAGAGGG - Intergenic
1029751390 7:102544536-102544558 TCTAGCACACACAGGGAAGAGGG + Intronic
1029769342 7:102643630-102643652 TCTAGCACACACAGGGAAGAGGG + Intronic
1029952427 7:104601378-104601400 CCTAGAACACATTTGGTACATGG - Intronic
1032449746 7:132019810-132019832 TCCAGAACACAAAGGGAAGAGGG - Intergenic
1032857190 7:135844809-135844831 CTAAGAACTCAGATTGAAGAAGG - Intergenic
1034099932 7:148442351-148442373 CATATAACACAGATGGAATCCGG - Intergenic
1038472293 8:27835486-27835508 AAGATAACACAGATGGAAGAAGG - Intronic
1038567184 8:28629501-28629523 TCTAGAATAAAGATGGCAGATGG - Intronic
1039928678 8:41962412-41962434 GCCAGAACACAGTTGGAAGACGG - Intronic
1041585454 8:59512207-59512229 ACTAGAACACAGATTGAGAATGG - Intergenic
1050585566 9:7108160-7108182 GTTAGAAGACACATGGAAGAGGG - Intergenic
1050774861 9:9247104-9247126 CCTAGAAGAAAGGTGGAAGAAGG - Intronic
1051309852 9:15758180-15758202 CCTTGAAAACAGCTGGAGGAAGG + Intronic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1051513468 9:17905615-17905637 CCTGGAAGACAGTTGGAAGGAGG + Intergenic
1052020994 9:23524991-23525013 CCCAGAGCACAGAGCGAAGAGGG - Intergenic
1052376260 9:27721157-27721179 CCAGGAACACAGATGTAGGAGGG + Intergenic
1055397625 9:75891454-75891476 GCTAGAGCACATCTGGAAGAGGG - Intronic
1056552120 9:87660376-87660398 CCTAGCAGCCACATGGAAGAAGG + Intronic
1060704457 9:125785356-125785378 GCTAGAACAAAGCAGGAAGAAGG + Intronic
1061283468 9:129610088-129610110 CGCAGACCACAGATGGAGGACGG - Intronic
1203431492 Un_GL000195v1:94555-94577 TCTAGTACCCAGATGGAAGGGGG + Intergenic
1185448561 X:271233-271255 CCCAGGACACAGAGGGAGGAAGG + Intergenic
1186956906 X:14692718-14692740 CCTAGACCAAAGATGGAAAATGG + Intronic
1187793536 X:22977100-22977122 CCTAAAACAAAGTTGGAAGGGGG + Intergenic
1188326405 X:28808035-28808057 CCTTGGACACAGAAAGAAGAAGG - Intronic
1189052815 X:37664253-37664275 CCTAGCACACACTTGGTAGAAGG - Intronic
1189261733 X:39684023-39684045 CCTAGAAAAGAAAAGGAAGAGGG - Intergenic
1190193163 X:48294266-48294288 CCTATAAGACAGATGAGAGACGG - Intergenic
1190462855 X:50695927-50695949 TCTGCAACACAGATTGAAGATGG - Exonic
1192872885 X:75201719-75201741 CCTAAAACAAAGATAGAAGTGGG + Intergenic
1194778989 X:97999690-97999712 TCGAGAATACAGATGTAAGAGGG - Intergenic
1195333306 X:103824849-103824871 CCTAGAACCCAGCTGCATGAAGG - Exonic
1196513137 X:116537727-116537749 CATAAAACACACATGAAAGATGG - Intergenic
1197816275 X:130501834-130501856 GGGAGAAGACAGATGGAAGAAGG - Intergenic
1198147811 X:133875402-133875424 CCTAGAACACAGCTGGCAAATGG + Intronic
1199405372 X:147452261-147452283 ACTAGAACAAAGCAGGAAGAAGG + Intergenic
1200411966 Y:2869737-2869759 CCTAAGAGACAGATGGAAGAAGG + Intronic