ID: 1062953217

View in Genome Browser
Species Human (GRCh38)
Location 10:1521339-1521361
Sequence AATGTCTAAGACAGTACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062953217 Original CRISPR AATGTCTAAGACAGTACAGG TGG (reversed) Intronic
904945734 1:34197512-34197534 AATGTCTGTGACAGTAGAAGTGG - Exonic
911933242 1:103932083-103932105 AATGTGTCAGACAGTACAATTGG + Intergenic
915391775 1:155550499-155550521 AAGGGCTAAAACAGTAAAGGGGG - Intronic
915685405 1:157627075-157627097 CATCTTTAAGACAGGACAGGTGG - Intergenic
916643434 1:166757227-166757249 AATGTGTGTGACAGTGCAGGGGG + Intergenic
917454854 1:175177467-175177489 AAAGTCAAAGCCAGAACAGGGGG - Intronic
918556522 1:185806901-185806923 AATGTATAAGACAGGAAATGAGG - Intronic
923965148 1:239129340-239129362 AATGTCTAAGACTGAAAATGAGG + Intergenic
924471255 1:244344484-244344506 AAAGACTAAGAGAGTACAGATGG - Intergenic
1062953217 10:1521339-1521361 AATGTCTAAGACAGTACAGGTGG - Intronic
1063159827 10:3411074-3411096 AATGTCTTAGTCTGTTCAGGTGG - Intergenic
1063320300 10:5045954-5045976 CAGGGCTGAGACAGTACAGGAGG + Intronic
1068113374 10:52708006-52708028 AATGTCTAAGACATTTAAGAGGG + Intergenic
1070376358 10:75834996-75835018 AATATCTAAAACAGTAGAAGTGG - Intronic
1073832241 10:107398182-107398204 AATTTCTAAGATGGTAGAGGTGG + Intergenic
1074321010 10:112402268-112402290 AATGTCTAAGAAAGTATACTGGG - Intronic
1076047137 10:127303295-127303317 AATGACTTAGACAGCAAAGGTGG + Intronic
1076921701 10:133457677-133457699 AATGTCTCATGCAGGACAGGGGG - Intergenic
1079380644 11:19934292-19934314 AATGTCCCAGGCAGCACAGGTGG - Intronic
1080300776 11:30782778-30782800 AGTGTTTTAGACACTACAGGAGG - Intergenic
1081753822 11:45530885-45530907 AGTTTCTCAGACAGAACAGGTGG + Intergenic
1086326476 11:85706506-85706528 GGTATTTAAGACAGTACAGGAGG + Intronic
1087177749 11:95110715-95110737 AATGTCTTAGAATGTACAGGAGG - Intronic
1088090645 11:106035348-106035370 AACTTCAAAGACAGCACAGGAGG + Intergenic
1088866586 11:113853500-113853522 AATATCTACGAGAGTATAGGAGG - Intronic
1088924893 11:114291804-114291826 AATGGCTAAGAGAGTAAAGGTGG - Intronic
1089991000 11:122859784-122859806 AAAGTGTAAGACAGTTCAGTGGG - Intronic
1091765167 12:3115354-3115376 TATGTCTAAGCCAGAAAAGGTGG - Intronic
1095266807 12:40169936-40169958 AATGTCTAAGACCATAGAAGTGG - Intergenic
1095592849 12:43923576-43923598 TATTTCTAAGACTGTACAAGAGG + Intronic
1096360268 12:50979222-50979244 CATGTCAAAGCCAGTAGAGGAGG - Intergenic
1098719208 12:73873894-73873916 AATTTCCAAGAGAGTACTGGAGG - Intergenic
1099618039 12:84964145-84964167 AATGCCTACCACATTACAGGGGG - Intergenic
1100555401 12:95688215-95688237 AATGACTAAGACAGTAGGTGTGG + Intronic
1101465233 12:104942107-104942129 AATGTTTAAGACAGAGTAGGGGG - Intronic
1103906909 12:124332540-124332562 AATGTCTAAGGCATCTCAGGTGG - Intronic
1108943241 13:55984987-55985009 AATGTCTAAGAGAATCCAGCAGG - Intergenic
1117077514 14:52119024-52119046 CATGGCTAAGACAGAAAAGGAGG + Intergenic
1119443443 14:74645204-74645226 ACTTTTTAAGACAGTAGAGGGGG + Intergenic
1125896347 15:43305734-43305756 AATGTGTAAGACACCAAAGGAGG - Intergenic
1127944528 15:63737062-63737084 AAAGTGTAAGACAGAACGGGAGG + Intronic
1128623117 15:69168992-69169014 AATGACTAAGAGAGTACAGGAGG - Intronic
1130863908 15:87915547-87915569 AATGTCTAAACCAGTCCTGGAGG + Intronic
1131007151 15:88987445-88987467 AATGCCTCAGACAGGAGAGGGGG - Intergenic
1131288796 15:91086821-91086843 AATGTCTGAGAGAGAAAAGGGGG - Intergenic
1134803176 16:17104248-17104270 AATGGCAAAGACAGTCTAGGAGG - Exonic
1137861357 16:51849904-51849926 AATGACTAACACATTGCAGGTGG - Intergenic
1138236499 16:55387784-55387806 AATGACTAAAACAGTGCATGTGG + Intergenic
1138272306 16:55703998-55704020 AATGCCTGAGACAGCCCAGGTGG + Intronic
1138524450 16:57594012-57594034 ATTGTTTAAAACTGTACAGGTGG - Intergenic
1145283040 17:21482160-21482182 AATGTCAAAGCCAGAAAAGGAGG + Intergenic
1150946264 17:69749393-69749415 AAAGTCTATGACAGTTCATGAGG - Intergenic
1157071295 18:44411927-44411949 AATGATAATGACAGTACAGGAGG + Intergenic
1159577772 18:70200855-70200877 AATCTCAAAGACACTCCAGGAGG + Intronic
1163803316 19:19381111-19381133 AGTGTCTGAGGCAGTCCAGGTGG - Intergenic
1166108235 19:40608039-40608061 AATGTCTTAGAGGCTACAGGTGG - Intronic
1166419710 19:42626906-42626928 CTTCTCTAAGACAGAACAGGTGG - Intronic
930679325 2:54239637-54239659 AATGACTAAGAAACTCCAGGGGG + Intronic
936583785 2:113732724-113732746 AATGTCTGATACACAACAGGAGG - Intronic
937136238 2:119556066-119556088 AATGTCTAAGACAATTCCAGGGG - Intronic
937520476 2:122707601-122707623 AATGTCTGAGAAAGCCCAGGTGG + Intergenic
942882710 2:180882572-180882594 ATTGTCTAAGAGAGTACACTGGG + Intergenic
943658253 2:190531517-190531539 AATTTCTAAGATGTTACAGGAGG + Intronic
944968909 2:204968719-204968741 AATCTTTAAAACAGTACAGTAGG + Intronic
947004044 2:225490077-225490099 CTTGTCAAAGACAGTTCAGGAGG - Intronic
948347776 2:237313516-237313538 TATGTTTAAGACAGCACAGAGGG - Intergenic
1169069309 20:2712990-2713012 TGTGTCTAAGAGAGAACAGGAGG + Intronic
1169710582 20:8557682-8557704 AATGACTAAAACAGTAAAGTTGG + Intronic
1175615797 20:60397329-60397351 AAGGTATAAGAGAGAACAGGAGG + Intergenic
1177451850 21:21278828-21278850 AATGTGTAATAAAGAACAGGAGG - Intronic
949350935 3:3124733-3124755 ATTGTCTTGGCCAGTACAGGAGG + Intronic
949538086 3:5011383-5011405 AATGGCAAAGACAGGACTGGAGG + Intergenic
950162005 3:10767334-10767356 AATGTCCAGGACAGTCCAGATGG - Intergenic
951453965 3:22870131-22870153 AATGACAAAGACAGTAGAAGAGG - Intergenic
954920551 3:54187243-54187265 AACATCTAAGACAGCCCAGGAGG - Intronic
955305935 3:57831913-57831935 AATGTTTAAGACAGTAGAACAGG - Intronic
956986711 3:74709650-74709672 AATGACTAAGTCAGTACAAGTGG + Intergenic
962687319 3:137860069-137860091 ACTGTCAAAGATAGGACAGGGGG - Intergenic
965073331 3:163943732-163943754 GATATCTCAGACAGTAAAGGTGG + Intergenic
967341354 3:188402182-188402204 AATATCCTAGACAGTAGAGGAGG + Intronic
969817637 4:9698214-9698236 AAGCTCTAAGACAGTCCTGGCGG - Intergenic
971997718 4:33988013-33988035 AATGTCCAAAACATTATAGGAGG + Intergenic
977520226 4:98073181-98073203 AATGTACAAGACAGGACAAGTGG - Intronic
980866518 4:138559726-138559748 TATTTCCAAGAAAGTACAGGTGG + Intergenic
981080912 4:140638151-140638173 AATTGCAAAGATAGTACAGGAGG - Intronic
981774548 4:148350311-148350333 AATTTCCAAGACATTTCAGGTGG + Intronic
983630725 4:169846555-169846577 AATGGCTAAGAGATTACAGAGGG + Intergenic
988256970 5:28832692-28832714 TATGTTTAAGATAGTACTGGGGG + Intergenic
989658862 5:43776568-43776590 AATAACTAAGACAGTATAAGCGG - Intergenic
990645090 5:57834848-57834870 GATTTCTACGACAGTAGAGGTGG + Intergenic
990928670 5:61060862-61060884 AATATCTAAGACCGTGGAGGAGG - Intronic
992763718 5:79975067-79975089 AATGTCTAAAGCATTCCAGGAGG + Intergenic
993168900 5:84390527-84390549 GCTGTCTGATACAGTACAGGTGG - Intergenic
994411935 5:99417622-99417644 AATGTGTAATACAGTAAAAGTGG + Intergenic
994481885 5:100347618-100347640 AATGTGTAATACAGTAAAAGTGG - Intergenic
994958501 5:106565900-106565922 GATGTCTAAAACACTATAGGAGG + Intergenic
995266409 5:110166801-110166823 AATATCTAAGACATTAGAGGGGG - Intergenic
996909301 5:128636783-128636805 AATGGGAAAGACAGTACAGCTGG + Intronic
998302763 5:141040916-141040938 AATGCGTAAGACAGCAAAGGCGG - Intergenic
998697746 5:144659430-144659452 AATGTCTCAGAAAGTCTAGGGGG - Intergenic
1000146783 5:158461249-158461271 AATGTCAAAGACTGTACTGATGG + Intergenic
1001227509 5:169957840-169957862 AATGCCTAAGGCAATGCAGGTGG - Intronic
1001835535 5:174828186-174828208 AATTTTTAAAACAGTACTGGGGG + Intergenic
1004165584 6:13253855-13253877 AAGGGCTAAGACAGTAAAGGAGG + Intronic
1004606856 6:17202948-17202970 AATGTTTAAGAAAGGAGAGGGGG + Intergenic
1010607133 6:77905061-77905083 AATTTTTAAGACAGTTCTGGGGG + Intronic
1011180525 6:84614549-84614571 AATGACTGAGACATTACAAGAGG + Intergenic
1018443959 6:163838018-163838040 AATGTCGATGTCAGTGCAGGGGG - Intergenic
1018983405 6:168617279-168617301 AATGTCTAATTATGTACAGGAGG + Intronic
1030412898 7:109204027-109204049 AAGGGCTAAGACAGTAGAGCAGG - Intergenic
1030677572 7:112399990-112400012 CATGGCTAACACAGTTCAGGAGG + Intergenic
1032414577 7:131726248-131726270 AGTGTCTAAAGCAGTCCAGGGGG - Intergenic
1033417085 7:141171700-141171722 AGTGTCTTAGACAGGGCAGGGGG + Intronic
1035797530 8:2372866-2372888 AATGTCTTAATCAGTACATGTGG - Intergenic
1035970973 8:4248668-4248690 AATGTCTAGGGCAGGACAGGAGG - Intronic
1038764897 8:30418366-30418388 AATCTCTAAGCCAGGCCAGGCGG - Intronic
1039228450 8:35416570-35416592 AATGTGTAAGAAAATACAGGTGG + Intronic
1041705794 8:60844951-60844973 AATGATTAAGACAGTACACCAGG - Exonic
1047503758 8:125462617-125462639 AATTTCAAAGACAGCACAGAGGG + Intergenic
1051049794 9:12917834-12917856 AATATCTTAGACCTTACAGGAGG - Intergenic
1053485584 9:38452722-38452744 CTTGTTTAAGAAAGTACAGGTGG - Intergenic
1055632063 9:78235031-78235053 AATGTCTAAGGCTCTACCGGAGG + Intergenic
1057926463 9:99155492-99155514 AATGTCTATATCAGTACAGTGGG + Intergenic
1059101998 9:111481192-111481214 ACTGTCAAAAACAGTACAGTGGG + Intronic
1060166830 9:121424306-121424328 AATGTCTACTACAGAACAGTAGG - Intergenic
1061383951 9:130277129-130277151 CATGTCTGAGACAGTTCATGGGG + Intergenic
1187980849 X:24755742-24755764 AATGTCTACGTCACTAGAGGAGG - Intronic
1188842845 X:35037264-35037286 AATCTGTAAAACAGTACAGATGG - Intergenic
1194401138 X:93439260-93439282 ACTGTCTAAGACAGAACACTGGG + Intergenic
1195882909 X:109611316-109611338 AATGTTTAGGAGAGTAGAGGAGG + Intergenic
1199907354 X:152246809-152246831 AATGAATAAGAAACTACAGGTGG + Intronic