ID: 1062955771

View in Genome Browser
Species Human (GRCh38)
Location 10:1539401-1539423
Sequence AGGCACACAGCACTGGTCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 222}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062955771_1062955780 8 Left 1062955771 10:1539401-1539423 CCATCGACCAGTGCTGTGTGCCT 0: 1
1: 0
2: 0
3: 10
4: 222
Right 1062955780 10:1539432-1539454 AGGCTACAGAAAGGGGACATTGG No data
1062955771_1062955776 -1 Left 1062955771 10:1539401-1539423 CCATCGACCAGTGCTGTGTGCCT 0: 1
1: 0
2: 0
3: 10
4: 222
Right 1062955776 10:1539423-1539445 TGGCTTCCAAGGCTACAGAAAGG No data
1062955771_1062955778 1 Left 1062955771 10:1539401-1539423 CCATCGACCAGTGCTGTGTGCCT 0: 1
1: 0
2: 0
3: 10
4: 222
Right 1062955778 10:1539425-1539447 GCTTCCAAGGCTACAGAAAGGGG No data
1062955771_1062955777 0 Left 1062955771 10:1539401-1539423 CCATCGACCAGTGCTGTGTGCCT 0: 1
1: 0
2: 0
3: 10
4: 222
Right 1062955777 10:1539424-1539446 GGCTTCCAAGGCTACAGAAAGGG No data
1062955771_1062955781 9 Left 1062955771 10:1539401-1539423 CCATCGACCAGTGCTGTGTGCCT 0: 1
1: 0
2: 0
3: 10
4: 222
Right 1062955781 10:1539433-1539455 GGCTACAGAAAGGGGACATTGGG No data
1062955771_1062955782 17 Left 1062955771 10:1539401-1539423 CCATCGACCAGTGCTGTGTGCCT 0: 1
1: 0
2: 0
3: 10
4: 222
Right 1062955782 10:1539441-1539463 AAAGGGGACATTGGGCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062955771 Original CRISPR AGGCACACAGCACTGGTCGA TGG (reversed) Intronic
904270252 1:29345123-29345145 AGGCACACAGCTCTGAGCTAGGG + Intergenic
904319543 1:29687950-29687972 AGGCACAGAGCTCTGGCCCATGG + Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
909873339 1:80772920-80772942 AGGCACACAGTGCTGCTCCAGGG - Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
913159716 1:116133813-116133835 AGGCACACAGCCCTGCTCAGAGG - Exonic
914285171 1:146218858-146218880 ATGCACACAGCACTGCACTAGGG + Intronic
914546202 1:148669597-148669619 ATGCACACAGCACTGCACTAGGG + Intronic
917196090 1:172467210-172467232 GGGAACACAGCACAGGTGGAAGG - Intronic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918596518 1:186300280-186300302 AGTCTCACAGCACTGCACGAGGG - Intronic
919056767 1:192580885-192580907 AGGCACACAGCAATGGTAAGGGG + Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920477668 1:206292362-206292384 AGTCACACAGCAAGGGTAGAAGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923039882 1:230312173-230312195 AGGCCCACAGCCCTGGGAGATGG + Intergenic
923779880 1:237012739-237012761 ACGTACACAGCACTGATCCAGGG - Intergenic
924050116 1:240071985-240072007 AGGGACACAGGACTGGTTGGTGG + Intronic
1062955771 10:1539401-1539423 AGGCACACAGCACTGGTCGATGG - Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1067552837 10:47247319-47247341 AGGCACCCAGCAGTGGAGGAGGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1073597440 10:104815061-104815083 AGACAAACAGCACTGATGGAAGG + Intronic
1074528817 10:114282785-114282807 ATGCACACAACACTGGTTCAGGG - Intronic
1075465104 10:122645175-122645197 AGGCACACAGCACCAGTGGCCGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1082788367 11:57330199-57330221 AGGCACCCAGCTCTGGCCCAAGG + Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085957741 11:81420918-81420940 AGGCACACAGCACAAGACAAAGG + Intergenic
1090304049 11:125674995-125675017 AGTCATACAGCAATGGTTGATGG - Intronic
1091281736 11:134385438-134385460 AGGCACACAGCAATTGCTGAGGG + Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094286011 12:28794454-28794476 AGCCACACAGCAGTGCTCCATGG - Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1097236641 12:57544939-57544961 AGGAACACACCACTGGGAGAAGG + Intronic
1104755994 12:131269634-131269656 GGGGACACAGCACTGGGCAAAGG + Intergenic
1104777719 12:131401047-131401069 GGGGACACAGCACTGGGCAAAGG - Intergenic
1106606213 13:31231666-31231688 AGGAACACTGCCCTGCTCGAAGG - Intronic
1108344095 13:49527308-49527330 AGTCAAACAGCATTGGTGGATGG + Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1112572724 13:100608385-100608407 AGGCAGAGAGCACTGGGCCAGGG + Intronic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1115310495 14:31974145-31974167 GGCCACCCAGCACTGGCCGAGGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120861415 14:89258148-89258170 AGGCAAACACCACTGCTCCAGGG - Intronic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1124975390 15:34524773-34524795 AGGGACTCAGCCCTGATCGAGGG + Intergenic
1125831460 15:42719704-42719726 GGGCAGACAGCACTGGCCCAGGG + Exonic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1134135513 16:11674146-11674168 AGGCAGACAGCACTGGAAGGAGG - Intronic
1136019779 16:27432722-27432744 AGACACACAGAACTTGTCGGTGG - Intronic
1136046497 16:27619402-27619424 AGGCCCACAGAACTGGTGGGGGG + Intronic
1136105489 16:28027079-28027101 GGACACACAGCAGTGGTGGAGGG + Intronic
1136672351 16:31869951-31869973 AGGCAGACATCCCTGGTCCAGGG - Intergenic
1142422153 16:89978222-89978244 AAGCACAAAGCACAGGTCCATGG - Intergenic
1146086611 17:29836434-29836456 AGGCACAGAGCACTAGGCAATGG - Intronic
1146913343 17:36662191-36662213 AGGGCCACAGCACTGATCCAGGG + Intergenic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1149169536 17:53792709-53792731 AACCACCCAGCACTGGTGGAGGG - Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1152253559 17:79224434-79224456 GGGCACACAGCGCTGGTCCCTGG + Intronic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1155154030 18:23143682-23143704 GGGCACAGAGCACTGGGCTAGGG - Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1160452847 18:78977807-78977829 AGGGCCAGAGCCCTGGTCGAAGG - Intergenic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1165883203 19:39057972-39057994 AGGATCCCAGTACTGGTCGAAGG + Intergenic
1165926091 19:39327208-39327230 AGGAAAACAGCACTAGTGGAGGG + Intergenic
1166355932 19:42227300-42227322 AGGCAGACAGCACTGCAAGAGGG + Exonic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG + Intergenic
927640187 2:24841113-24841135 TGGGACACAGCACTGGTTGATGG - Intronic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930134077 2:47883364-47883386 ATGCACAGGGCACTGGTCGCAGG - Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
934736694 2:96693287-96693309 AGGCATACAGAACTCGTGGATGG + Intergenic
938702618 2:133893037-133893059 AGGCACCCAGAGCTGGTCAAAGG + Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939516099 2:143170043-143170065 AGGCACACAGAGCAGCTCGAAGG - Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
942551858 2:177128011-177128033 AGGCACACAGCCCAGGTTGGTGG - Intergenic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
945834118 2:214818945-214818967 TAGCACACACCACTGGTGGATGG - Intergenic
948087529 2:235263983-235264005 TGTCACACAGCCCTGGTGGATGG - Intergenic
1169056391 20:2624929-2624951 GGGCCCACAGCACTACTCGATGG + Intronic
1169374672 20:5056922-5056944 AGTCACACAGCACTGTTTGCAGG - Intergenic
1169421592 20:5465103-5465125 AGCCGCCCAGCACTGGTGGAGGG - Intergenic
1170703340 20:18724015-18724037 AGACACACAGCAATGATCAAAGG + Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172390586 20:34562338-34562360 AGGCACAGAGCACTTGGCTATGG + Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1179036446 21:37762609-37762631 AGGCACACAGCTGTGGGCGTTGG - Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179807933 21:43851901-43851923 ACGCACACAGCCCTGGTCGGGGG + Intergenic
1181466189 22:23111977-23111999 AGGGACAGAGGACTGGTCTAAGG - Intronic
1182098563 22:27642154-27642176 AGGAACACAGCAGGGGTCGAGGG + Intergenic
1182326543 22:29517546-29517568 AAGCACATAGCACTGGGTGAAGG - Intronic
1182919467 22:34066109-34066131 AGGCAGCCAGCACAGGGCGAGGG + Intergenic
1184422977 22:44392523-44392545 AGGCACACAGCTCTGGCCCAAGG + Intergenic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951749064 3:26013721-26013743 AGGCACCCAGCACAGCTCGGAGG + Intergenic
953282970 3:41576379-41576401 AGGCACTCAGCATTGGGTGAGGG - Intronic
954532142 3:51330242-51330264 AGGCACACCACACTGGGGGATGG + Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
962274352 3:134000857-134000879 AGGCACAAAGCTCTGGTCTCAGG - Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
967607902 3:191470035-191470057 AGGAACACAGTTCTTGTCGAAGG + Intergenic
969108211 4:4824045-4824067 ATTCACACAGCACTGGACTAGGG - Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969571764 4:8012943-8012965 AGGCACTCAGCACAGGGAGATGG - Intronic
969640561 4:8395802-8395824 AGGCTCATAGCCCTGGTCAAAGG + Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975410028 4:74038671-74038693 AGCCACACAGCCCGGGTCGCAGG - Exonic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979268523 4:118732053-118732075 GGGCACACAGCACTGGGCCAGGG + Intronic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
982990606 4:162269169-162269191 AGGCACCCATCACTGGTGGACGG + Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984373340 4:178894645-178894667 AGCCGCACAGCACCGGTGGAGGG + Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
987988463 5:25180474-25180496 AAGGGCACAGAACTGGTCGAAGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992932635 5:81665343-81665365 TGCCACACAGCACTGATGGATGG + Intronic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1000970931 5:167713961-167713983 TGGCACACAGGACTGTTCAATGG - Intronic
1002291513 5:178204052-178204074 AGGCCCTCAGCACGGGTCGGAGG - Intergenic
1002593529 5:180307040-180307062 AGGCTCACAGGACTGGCCAAGGG + Intronic
1004893747 6:20126940-20126962 AGGCACTCAGAGCTGGGCGAGGG + Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1017235439 6:152113094-152113116 AGACACACAGCACTGGCGGCAGG - Intronic
1018231229 6:161677602-161677624 ACACACACTGCACTGGTGGATGG + Intronic
1018614150 6:165670096-165670118 AGCCACACACCAATGGTGGACGG + Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022405153 7:30082395-30082417 AGGCACGCAGCCCTGGGCTAAGG - Exonic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1026448430 7:70506050-70506072 AGGCACAGAGCACTGGAACACGG + Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029963978 7:104718843-104718865 AGGCACACAGAACTGCTAGCAGG + Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034266812 7:149785126-149785148 AGGCACACAGCGCTCGTCCTGGG - Intergenic
1034429041 7:151031586-151031608 AGGCAGACAGGACTGGTTGTAGG - Intronic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040518430 8:48153655-48153677 ACCCAGACAGCACTGGTAGAGGG - Intergenic
1041395106 8:57381752-57381774 GGGCACATAGCATTGCTCGAAGG + Intergenic
1041896888 8:62935200-62935222 AGGGACACAACACTGTTCGGGGG + Intronic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1043673537 8:82919855-82919877 TGGCACACAGCACTGGTGATTGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047880359 8:129186214-129186236 GGGCACAAAGCACTGGTGGTGGG - Intergenic
1049238771 8:141525946-141525968 AGGCACACAGCAATGGCAGGCGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1056064537 9:82920361-82920383 AGGCAGACATCACTAGTCAATGG - Intergenic
1056752243 9:89360742-89360764 AAGCACACAGCTCTGGGCCAGGG + Intergenic
1056800124 9:89685318-89685340 AGTCACACAGCACAGATCCAAGG - Intergenic
1059895259 9:118856719-118856741 AGGGACACAGAACTGGACGGAGG + Intergenic
1189390450 X:40571870-40571892 AAGCACACAGCAATGGATGAAGG - Intergenic
1190295470 X:49024523-49024545 AGGCAGGGAGCACTGGTTGAGGG - Intergenic
1190408361 X:50110218-50110240 AGGGCCACAGGACTGGTTGAGGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1193614593 X:83671827-83671849 AGGCACACAGCACTAGCTGTCGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1200017931 X:153180076-153180098 AGGCACACACCCCAGGTAGATGG + Intronic