ID: 1062956888

View in Genome Browser
Species Human (GRCh38)
Location 10:1546413-1546435
Sequence GCAGGTGGTAATTTTAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062956888_1062956892 26 Left 1062956888 10:1546413-1546435 CCAGCTCTAAAATTACCACCTGC No data
Right 1062956892 10:1546462-1546484 CTGTCCTGCTCCTGACTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062956888 Original CRISPR GCAGGTGGTAATTTTAGAGC TGG (reversed) Intronic
No off target data available for this crispr