ID: 1062957022

View in Genome Browser
Species Human (GRCh38)
Location 10:1547185-1547207
Sequence AGGTGTATACACTGTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062957016_1062957022 7 Left 1062957016 10:1547155-1547177 CCTTTGGGGAAACTGGGAGAGAT 0: 1
1: 0
2: 1
3: 21
4: 241
Right 1062957022 10:1547185-1547207 AGGTGTATACACTGTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062957022 Original CRISPR AGGTGTATACACTGTGGGGA GGG Intronic
No off target data available for this crispr