ID: 1062960307

View in Genome Browser
Species Human (GRCh38)
Location 10:1568247-1568269
Sequence ATATTGGTCTAGATGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062960301_1062960307 -1 Left 1062960301 10:1568225-1568247 CCTGACTCTGCCCTGGTGTCCTA 0: 1
1: 0
2: 4
3: 16
4: 219
Right 1062960307 10:1568247-1568269 ATATTGGTCTAGATGGAGCTTGG No data
1062960297_1062960307 14 Left 1062960297 10:1568210-1568232 CCAGGCCTCCGCTGTCCTGACTC 0: 1
1: 0
2: 3
3: 27
4: 333
Right 1062960307 10:1568247-1568269 ATATTGGTCTAGATGGAGCTTGG No data
1062960298_1062960307 9 Left 1062960298 10:1568215-1568237 CCTCCGCTGTCCTGACTCTGCCC 0: 1
1: 0
2: 2
3: 32
4: 388
Right 1062960307 10:1568247-1568269 ATATTGGTCTAGATGGAGCTTGG No data
1062960299_1062960307 6 Left 1062960299 10:1568218-1568240 CCGCTGTCCTGACTCTGCCCTGG 0: 1
1: 0
2: 4
3: 120
4: 569
Right 1062960307 10:1568247-1568269 ATATTGGTCTAGATGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062960307 Original CRISPR ATATTGGTCTAGATGGAGCT TGG Intronic
No off target data available for this crispr