ID: 1062962219

View in Genome Browser
Species Human (GRCh38)
Location 10:1581122-1581144
Sequence TGTATTGGCGAGGATATAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 68}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062962219_1062962227 10 Left 1062962219 10:1581122-1581144 CCCTCTATATCCTCGCCAATACA 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1062962227 10:1581155-1581177 GCAGGGATAGAACCTGGTCTGGG No data
1062962219_1062962223 -8 Left 1062962219 10:1581122-1581144 CCCTCTATATCCTCGCCAATACA 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1062962223 10:1581137-1581159 CCAATACACTGACTAGAAGCAGG No data
1062962219_1062962225 4 Left 1062962219 10:1581122-1581144 CCCTCTATATCCTCGCCAATACA 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1062962225 10:1581149-1581171 CTAGAAGCAGGGATAGAACCTGG No data
1062962219_1062962226 9 Left 1062962219 10:1581122-1581144 CCCTCTATATCCTCGCCAATACA 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1062962226 10:1581154-1581176 AGCAGGGATAGAACCTGGTCTGG No data
1062962219_1062962224 -7 Left 1062962219 10:1581122-1581144 CCCTCTATATCCTCGCCAATACA 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1062962224 10:1581138-1581160 CAATACACTGACTAGAAGCAGGG No data
1062962219_1062962229 25 Left 1062962219 10:1581122-1581144 CCCTCTATATCCTCGCCAATACA 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1062962229 10:1581170-1581192 GGTCTGGGAGAAGACTGCTGTGG No data
1062962219_1062962231 27 Left 1062962219 10:1581122-1581144 CCCTCTATATCCTCGCCAATACA 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1062962231 10:1581172-1581194 TCTGGGAGAAGACTGCTGTGGGG No data
1062962219_1062962230 26 Left 1062962219 10:1581122-1581144 CCCTCTATATCCTCGCCAATACA 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1062962230 10:1581171-1581193 GTCTGGGAGAAGACTGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062962219 Original CRISPR TGTATTGGCGAGGATATAGA GGG (reversed) Intronic
913303783 1:117401468-117401490 TGGATTGGGGTGGATATAGAGGG + Intronic
916321411 1:163509046-163509068 GGTATTGATTAGGATATAGAAGG - Intergenic
924548781 1:245054673-245054695 TGTATTGGCTGGGAAAGAGAAGG - Intronic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1064415372 10:15144868-15144890 TGTAATGGCTAGGGTATACAGGG - Intronic
1088969275 11:114757927-114757949 TTTATTGGGGAGGAAATATAGGG + Intergenic
1091151329 11:133331023-133331045 TGTATTGGAAAGCAGATAGAGGG - Intronic
1093639778 12:21512892-21512914 TGTATTTGCGGGGGTAGAGATGG - Intronic
1094209035 12:27870926-27870948 TATATTGTCCAGGATATTGAAGG - Intergenic
1099403268 12:82226337-82226359 TGTATTGGCAGGGATATACTGGG - Intronic
1104530236 12:129563392-129563414 TGCATAGCTGAGGATATAGATGG + Intronic
1107957622 13:45531826-45531848 TGTAGTGGAGAGGAGAAAGATGG + Intronic
1109916203 13:68987947-68987969 TGTATTGTTTAGCATATAGAAGG - Intergenic
1111745470 13:92263420-92263442 TGTATTGGAGAGGAAAAAGAAGG - Intronic
1112765268 13:102735062-102735084 TGAAGTGGGGAGGATCTAGAAGG + Exonic
1112920618 13:104607351-104607373 GGTATTGCCGAGGATATTGAAGG - Intergenic
1118975920 14:70676687-70676709 TGTATGGGCGAGGAAAATGAGGG - Intergenic
1119869708 14:78006314-78006336 TGCAGTGGCAAGGATATAAAGGG - Intergenic
1125172007 15:36776272-36776294 TGTATTGGAGAGAATATTCAGGG + Intronic
1130693171 15:86104178-86104200 GGTATTGGGGAGGATAAAGATGG + Intergenic
1131382607 15:91976183-91976205 TGTACTGGGGAGAAGATAGATGG + Intronic
1138544625 16:57708741-57708763 AGTATTGGCAAGGATGTGGATGG - Intronic
1138728354 16:59165809-59165831 TTTATTGGCCAGTATATAGCAGG - Intergenic
1141070260 16:80948210-80948232 TGCACTGGCAAGGATGTAGAGGG - Intergenic
1142576539 17:912466-912488 AGTGTTGGCAAGGATGTAGACGG - Intronic
1143940758 17:10538722-10538744 GGCATTGCAGAGGATATAGAAGG - Intronic
1152053967 17:78007198-78007220 AGTATTTTAGAGGATATAGAAGG - Intronic
1157085558 18:44577061-44577083 GGCAATGGAGAGGATATAGAGGG - Intergenic
1159772709 18:72566169-72566191 GGTGTTGGCCAGGATATGGAGGG + Intronic
1164286698 19:23823245-23823267 TGTATTGGGGAGGAAATGGGAGG - Intronic
928069871 2:28203940-28203962 AGTATTGGCAAGGATGTAGGAGG - Intronic
938402019 2:131001527-131001549 AGTATTGGTGAGGATGTACAGGG + Intronic
945800801 2:214427899-214427921 TGTATTGGAAAGGAAATGGATGG - Intronic
1170434221 20:16308567-16308589 TGTCTTGGGGAGGAGAAAGAGGG - Intronic
1174871098 20:54183128-54183150 AGTGTTGGGGAGGATGTAGAGGG - Intergenic
1181898320 22:26130722-26130744 AGTGTTGGCGAGGATGTGGAGGG - Intergenic
950680034 3:14578874-14578896 TTTATTGGAGAGGAAATTGAGGG - Intergenic
953061929 3:39434747-39434769 AGTATTGGCGGGGATACAGAGGG - Intergenic
955064673 3:55524172-55524194 TGTATGGGCGAGTATAGAGGGGG - Intronic
955870722 3:63435729-63435751 TGTATATGTGAGAATATAGATGG - Intronic
959099201 3:101991320-101991342 TGTATGGGTGAAGATATAAAAGG + Intergenic
961796848 3:129415300-129415322 GGTATTGGCCAGGATATCCATGG + Exonic
963057681 3:141200765-141200787 TGGATTGGTGAGTAGATAGATGG + Intergenic
965288324 3:166844837-166844859 TGCAATGGCAAGGATATACAAGG - Intergenic
972636833 4:40891854-40891876 TTTCTTGGCTAGGATTTAGAAGG - Intronic
974322023 4:60362948-60362970 TGAATTTGCGAGCATAGAGATGG - Intergenic
976381099 4:84399958-84399980 TGGATTTGGGAGGATATAGAGGG + Intergenic
983424602 4:167567418-167567440 TTTCTTTGCGAGGACATAGATGG + Intergenic
985007826 4:185551754-185551776 TGTAATGGCTAGTATATAGCAGG - Intergenic
987785053 5:22488828-22488850 AGTATTGGCCAGTAGATAGAGGG - Intronic
996824598 5:127667583-127667605 TGTGTTGGCTAGGAAATATAAGG - Intergenic
997111302 5:131077924-131077946 TGTGTCGGAGAGGATATAAAGGG - Intergenic
1001904167 5:175457265-175457287 GGTGTTGGTGAGGATGTAGAGGG + Intergenic
1005626032 6:27663417-27663439 TGGATTGGCTAGGAAATAAAAGG + Intergenic
1007993932 6:46286549-46286571 TGTTTTGGCCAGAATAAAGATGG + Intronic
1008975188 6:57417942-57417964 TTGATTAGCGAGGATCTAGATGG - Intronic
1010993208 6:82502848-82502870 TGTTTTGTGAAGGATATAGAGGG - Intergenic
1011703595 6:89979332-89979354 TGTGTTGGCCTGGATATATAGGG + Intronic
1016704086 6:147086788-147086810 AGTGTTAGTGAGGATATAGAGGG + Intergenic
1017463549 6:154673609-154673631 TGTCTTGTAGAGGGTATAGATGG - Intergenic
1018336353 6:162794108-162794130 AGTGTTGGTGAGGATATGGAGGG - Intronic
1030341495 7:108385782-108385804 TGTATTGGAGAGAATATGGAAGG + Intronic
1033469944 7:141637469-141637491 TGTATTGGAGAGTATAGATATGG + Intronic
1036452546 8:8881525-8881547 TATAGTGGGGAGCATATAGATGG - Intronic
1039079212 8:33719408-33719430 TGTGTAGACGAGGATAGAGATGG - Intergenic
1039222657 8:35351876-35351898 GATATTGGCATGGATATAGAAGG + Intronic
1039294182 8:36131431-36131453 AGTCTTGGCAAGGAAATAGAAGG - Intergenic
1043566631 8:81556250-81556272 TGATTTGGTGAGGATACAGAAGG + Intergenic
1044052855 8:87530614-87530636 TGTGATGGCAAGGATATAAAAGG + Intronic
1051988508 9:23121411-23121433 AGTTTTGGAGAGGATAAAGATGG + Intergenic
1052652547 9:31322201-31322223 TTTATTGGCTAAAATATAGAAGG + Intergenic
1053192649 9:36086005-36086027 TGTATTGGCAAAGATGGAGACGG - Intronic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic
1188485777 X:30680431-30680453 GGGGTTGGTGAGGATATAGAGGG + Intronic
1195598641 X:106721613-106721635 TATATGGGCCAGGATATATATGG - Intronic
1195616823 X:106919218-106919240 TGTATTGTAGAAGATATCGATGG - Intronic