ID: 1062962224

View in Genome Browser
Species Human (GRCh38)
Location 10:1581138-1581160
Sequence CAATACACTGACTAGAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062962219_1062962224 -7 Left 1062962219 10:1581122-1581144 CCCTCTATATCCTCGCCAATACA 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1062962224 10:1581138-1581160 CAATACACTGACTAGAAGCAGGG No data
1062962220_1062962224 -8 Left 1062962220 10:1581123-1581145 CCTCTATATCCTCGCCAATACAC 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1062962224 10:1581138-1581160 CAATACACTGACTAGAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062962224 Original CRISPR CAATACACTGACTAGAAGCA GGG Intronic
No off target data available for this crispr