ID: 1062962226

View in Genome Browser
Species Human (GRCh38)
Location 10:1581154-1581176
Sequence AGCAGGGATAGAACCTGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062962219_1062962226 9 Left 1062962219 10:1581122-1581144 CCCTCTATATCCTCGCCAATACA 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1062962226 10:1581154-1581176 AGCAGGGATAGAACCTGGTCTGG No data
1062962220_1062962226 8 Left 1062962220 10:1581123-1581145 CCTCTATATCCTCGCCAATACAC 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1062962226 10:1581154-1581176 AGCAGGGATAGAACCTGGTCTGG No data
1062962221_1062962226 -1 Left 1062962221 10:1581132-1581154 CCTCGCCAATACACTGACTAGAA 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1062962226 10:1581154-1581176 AGCAGGGATAGAACCTGGTCTGG No data
1062962222_1062962226 -6 Left 1062962222 10:1581137-1581159 CCAATACACTGACTAGAAGCAGG 0: 1
1: 0
2: 0
3: 11
4: 85
Right 1062962226 10:1581154-1581176 AGCAGGGATAGAACCTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062962226 Original CRISPR AGCAGGGATAGAACCTGGTC TGG Intronic
No off target data available for this crispr