ID: 1062969004

View in Genome Browser
Species Human (GRCh38)
Location 10:1631430-1631452
Sequence CGCCCTGGCATGACACCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062969004_1062969011 27 Left 1062969004 10:1631430-1631452 CCAGCTGGTGTCATGCCAGGGCG No data
Right 1062969011 10:1631480-1631502 GCGCAAAAAATATGCTTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062969004 Original CRISPR CGCCCTGGCATGACACCAGC TGG (reversed) Intronic
No off target data available for this crispr