ID: 1062970798

View in Genome Browser
Species Human (GRCh38)
Location 10:1646886-1646908
Sequence GGTCGCAGGCACGCAGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 127}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062970798_1062970807 28 Left 1062970798 10:1646886-1646908 CCAGTGCCTGCGTGCCTGCGACC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1062970807 10:1646937-1646959 AAATAAGGTGGCTGTCAGTGAGG No data
1062970798_1062970808 29 Left 1062970798 10:1646886-1646908 CCAGTGCCTGCGTGCCTGCGACC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1062970808 10:1646938-1646960 AATAAGGTGGCTGTCAGTGAGGG No data
1062970798_1062970805 16 Left 1062970798 10:1646886-1646908 CCAGTGCCTGCGTGCCTGCGACC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1062970805 10:1646925-1646947 TCTGGATCCTAGAAATAAGGTGG No data
1062970798_1062970802 -2 Left 1062970798 10:1646886-1646908 CCAGTGCCTGCGTGCCTGCGACC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1062970802 10:1646907-1646929 CCAGCATGCAAGAGTTCCTCTGG No data
1062970798_1062970803 13 Left 1062970798 10:1646886-1646908 CCAGTGCCTGCGTGCCTGCGACC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1062970803 10:1646922-1646944 TCCTCTGGATCCTAGAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062970798 Original CRISPR GGTCGCAGGCACGCAGGCAC TGG (reversed) Intronic
900399323 1:2466575-2466597 GCAGGCAGGCACGCAGGCCCGGG - Intronic
901225519 1:7610934-7610956 GGTCCCAGGCCCCCAGGCAGAGG + Intronic
902218579 1:14950288-14950310 GGTTGCAGGCAGGCAAGAACAGG - Intronic
902754772 1:18541650-18541672 AGACGCAGGCACGGAGACACAGG - Intergenic
905296752 1:36959277-36959299 GGGCACAGGCTCACAGGCACAGG - Intronic
912682642 1:111739038-111739060 GGACGCGGGCCCGCAGGCAGAGG - Intronic
915304252 1:154968859-154968881 GGAGGCAGGCAGGCAGGCGCTGG - Intronic
916106961 1:161440095-161440117 GCGCACAGGCACGCAGCCACAGG + Intergenic
916108520 1:161447509-161447531 GCGCACAGGCACGCAGCCACAGG + Intergenic
916110108 1:161454890-161454912 GCGCACAGGCACGCAGCCACAGG + Intergenic
916111693 1:161462300-161462322 GCGCACAGGCACGCAGCCACAGG + Intergenic
916113280 1:161469681-161469703 GCGCACAGGCACGCAGCCACAGG + Intergenic
923521650 1:234739526-234739548 GGTTGCTGGCAGGCAGGGACCGG - Intergenic
1062970798 10:1646886-1646908 GGTCGCAGGCACGCAGGCACTGG - Intronic
1068937328 10:62648675-62648697 GGTGGCAGACAGACAGGCACTGG - Intronic
1069858232 10:71453507-71453529 GCTGGCAGGCACGGAGGCATAGG + Intronic
1075636153 10:124031886-124031908 GGTGGCAGGAACACAGGCATTGG - Intronic
1076306129 10:129466958-129466980 GGACGCCGGCACGCCGGCCCTGG - Intergenic
1076449575 10:130547396-130547418 GATGGCAGGCACGTGGGCACTGG - Intergenic
1076691637 10:132226652-132226674 GGGGGCAGGCACTCAGGCAAGGG + Intronic
1077062773 11:625135-625157 GGTCACAGGCACCGAGGCACAGG + Exonic
1077144583 11:1039172-1039194 ACTCACAGGCACACAGGCACAGG - Intergenic
1077412479 11:2410100-2410122 GGTCGCAGGCAGGCAGGGTCTGG + Intronic
1077530602 11:3093046-3093068 GGTCACTGGCCCGCAGGCTCTGG - Exonic
1081727677 11:45342570-45342592 GGTCACAGCAAGGCAGGCACAGG + Intergenic
1088883086 11:113986920-113986942 TGACGCAGCCAAGCAGGCACGGG - Exonic
1091323447 11:134667441-134667463 TGGCGCAGGCTGGCAGGCACTGG + Intergenic
1099277211 12:80591793-80591815 GGCAGCAGGCACAAAGGCACAGG - Intronic
1103558433 12:121779644-121779666 GTTCGCAGGCGCTCAGGCCCTGG + Exonic
1111657861 13:91175178-91175200 GCTCCCAGGCCCGCGGGCACCGG - Intergenic
1113418685 13:110152680-110152702 GGCCCCAGCCATGCAGGCACTGG - Intronic
1113437297 13:110303288-110303310 GGTGGCAGGTAGGCAGGCAGGGG - Intronic
1113764721 13:112874211-112874233 AGCAGCAGGCACGCAGGCCCGGG + Intronic
1113781828 13:112981627-112981649 GGTCTCAGGCTCGCAGGCCCAGG - Intronic
1113847019 13:113398016-113398038 GGAGGCCGGCAAGCAGGCACTGG + Intergenic
1115154438 14:30321969-30321991 GCTGGCAGGCACACAGACACGGG - Intergenic
1118254876 14:64196908-64196930 GCTGGCTGGCTCGCAGGCACAGG - Intronic
1119035929 14:71230841-71230863 GGCAGCAGGGACGCAGGCAGTGG + Intergenic
1119420682 14:74506099-74506121 GGTCACTGGCACAGAGGCACAGG + Exonic
1121577791 14:95002522-95002544 GATGCCAGGCAGGCAGGCACAGG + Intergenic
1122785997 14:104163552-104163574 GGTCTCAGGCACACAGGCCCGGG + Intronic
1202904061 14_GL000194v1_random:58588-58610 GGCCGCAGAGACCCAGGCACTGG - Intergenic
1124633337 15:31349706-31349728 GGTCACAGGCACAGGGGCACAGG - Intronic
1125471016 15:40003756-40003778 GGTCGGAAGAAAGCAGGCACGGG - Intronic
1132398321 15:101489842-101489864 GGTCGCAGGAGCGCGGGCCCGGG - Intronic
1132748369 16:1446282-1446304 GGGCACAGGCACGCAGGTGCCGG + Exonic
1133024742 16:2983678-2983700 GGTCACAGGGACCGAGGCACGGG + Intergenic
1134096312 16:11421116-11421138 GGCCCCAGGCACTCAGGCTCAGG + Intronic
1136296943 16:29309173-29309195 GGGCACAGGCAGGGAGGCACAGG - Intergenic
1136402354 16:30025524-30025546 GGTCGCAGGGAGGCAGGGAGAGG - Intronic
1136412227 16:30084156-30084178 TGTCACAGGCACACACGCACAGG + Intronic
1136509722 16:30729406-30729428 GGTGGCAGGCATGCAGGGAAGGG - Exonic
1136605765 16:31332250-31332272 GGCCGCAGGCTCGCAGGCGACGG - Exonic
1138272991 16:55709651-55709673 GGTTGCATGCACTCAGGCCCAGG - Intergenic
1139472886 16:67187622-67187644 GGCCGCAGGGAAGCTGGCACGGG - Exonic
1140092020 16:71846305-71846327 GCTCGCAGGCACACAGCCTCCGG - Intronic
1143957257 17:10680797-10680819 GTTCGCAGGCAGGAATGCACTGG + Exonic
1144121444 17:12157800-12157822 GGTGGCAGGCAAGCAGGAGCAGG - Intergenic
1146274576 17:31508588-31508610 GGCCGCGTGCACCCAGGCACTGG - Intronic
1146902180 17:36595822-36595844 GTTCCCAAGCACCCAGGCACAGG - Intronic
1148049238 17:44761004-44761026 GGTCCAAGGCCCGCAGTCACTGG + Intronic
1151945899 17:77319693-77319715 CGAGGCAGGCACGCAGGAACTGG + Intronic
1152809503 17:82374915-82374937 GGCCCCAGGCGGGCAGGCACAGG - Exonic
1153451935 18:5239011-5239033 GGTCTGAGGAACGCAGGCCCTGG + Intergenic
1155903479 18:31420057-31420079 GCTCACAGGCTAGCAGGCACAGG - Intergenic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1165939213 19:39406953-39406975 GGACTCAGGCATGCAGGTACCGG - Intronic
1167356315 19:49006434-49006456 GCAGGCAGGCAGGCAGGCACTGG - Intronic
1167748569 19:51367049-51367071 GGTCGTGGGGACGCAGGCACGGG - Intronic
926594914 2:14779550-14779572 GATAGCAGGCACAAAGGCACTGG - Intergenic
928094326 2:28394438-28394460 GGGGGCAGGCAGGCAGGCAGGGG - Intronic
944716267 2:202377682-202377704 TGGGGCAGGCGCGCAGGCACCGG - Intronic
946302812 2:218834651-218834673 GCAGGCAGGCAGGCAGGCACGGG + Intergenic
946581304 2:221130815-221130837 GGTGGGAGACAGGCAGGCACAGG - Intergenic
947950499 2:234142960-234142982 GGTCTCAGGCACGTGGTCACAGG + Intergenic
1171223517 20:23421477-23421499 GGCCGCAGGGACGCAGGCGCAGG + Exonic
1172187737 20:33041803-33041825 GGTAGCAGGCAAGCAGACTCAGG + Intronic
1174124791 20:48296344-48296366 TGTCACATGCACCCAGGCACTGG + Intergenic
1176084116 20:63288180-63288202 GGCCGCTGGAACGCAGTCACAGG - Exonic
1176381625 21:6116745-6116767 GCTGGCAGGCACGGAGGCCCCGG + Intronic
1177775514 21:25562109-25562131 GGTCGCACGTTCGCAGGCGCGGG + Intergenic
1178146932 21:29751007-29751029 GTTCGCTGGCAGGCAGGGACAGG + Intronic
1179741847 21:43421494-43421516 GCTGGCAGGCACGGAGGCCCCGG - Intronic
1180067301 21:45418818-45418840 CCTCGCAGGGCCGCAGGCACAGG - Intronic
1180950306 22:19717926-19717948 GCACGCACGCACGCACGCACGGG + Intronic
1181766281 22:25094456-25094478 GGTGGGAGGCAAGCAGGCCCTGG + Intronic
1181842311 22:25674500-25674522 GGTTGCAGGAAAGCAGACACTGG + Exonic
1183121978 22:35737101-35737123 GGTAGAAGGCAGGCAGCCACAGG + Intergenic
1183383039 22:37499969-37499991 GGTCACAGGCAGACAGGAACGGG + Intronic
1183649451 22:39145663-39145685 GGCCGCGCGCACGCACGCACGGG + Intronic
1185339174 22:50284020-50284042 GGTCGGGGGCGGGCAGGCACGGG - Intronic
950012331 3:9732136-9732158 GGTCCCAGGCCCGCACTCACCGG - Exonic
950024364 3:9810306-9810328 GGTCCCAGGCACCCACGCCCAGG + Exonic
951776246 3:26313176-26313198 GCACGCAGACAGGCAGGCACAGG - Intergenic
954442734 3:50530584-50530606 GGGCGCAGGGACGCAGGGACGGG + Intergenic
955979740 3:64512815-64512837 GGTAGCAGGCACTCTGGGACTGG - Intergenic
960887623 3:122412607-122412629 GGTTGCAGGCAGGCCGGCAGTGG + Exonic
961018459 3:123484745-123484767 GGACACAGGCAGGCAGGCACAGG + Intergenic
961317664 3:126051506-126051528 GGCAGCAGGCACGCAGTCCCTGG - Intronic
965901227 3:173644411-173644433 GGTAGCAGCCATGCAGACACAGG - Intronic
967712716 3:192727588-192727610 GGGCGCTGGCACGCATGCGCAGG + Intronic
968466983 4:757295-757317 TGTGCCAGCCACGCAGGCACAGG - Intronic
968599815 4:1503629-1503651 GGCCGCAGGCTTGCAGGCAGCGG - Intergenic
969114094 4:4860453-4860475 GGCTGCAGGTACGCAGGCGCCGG - Intronic
970277886 4:14421618-14421640 GGACACAGGCACACAGGCATGGG - Intergenic
970317115 4:14839933-14839955 GGACACAGGCACACAGGCATGGG + Intergenic
973571416 4:52243366-52243388 GGTCCCAGGCACACAGGTTCAGG + Intergenic
980981450 4:139657798-139657820 AGTCACAGGCCCGCATGCACAGG + Intergenic
984811284 4:183798045-183798067 GGTCGCACTCACCCAGGCAGCGG - Intergenic
985747049 5:1653603-1653625 AGTTGCACGCACACAGGCACAGG - Intergenic
992542211 5:77776344-77776366 GGTCGCCGGCGCGCATGCGCAGG + Exonic
996196009 5:120608019-120608041 AGTCACAGGCATGCAGGCAATGG + Intronic
1001080872 5:168666430-168666452 GGTGGCAGGCAGGCGGGCAGGGG + Exonic
1019273564 7:164198-164220 GGCAGGAGGCACGCAGGCCCCGG + Intergenic
1019526834 7:1484240-1484262 CGTCGCAGGCACGCTCTCACTGG + Intronic
1019696718 7:2450429-2450451 CGTTCCAGGCAGGCAGGCACAGG + Intergenic
1020116413 7:5478861-5478883 AGGCACACGCACGCAGGCACGGG + Intronic
1022606098 7:31815653-31815675 GCTGGCAGGCAGGCAGGCACTGG + Intronic
1024524432 7:50336414-50336436 GGTTGCAGGCTCAGAGGCACAGG + Intronic
1029238834 7:99144158-99144180 GCGCGCACGCACGCAGGCGCGGG - Intergenic
1034154212 7:148941201-148941223 GTTCGCAGCCACGCGGGCTCCGG - Intergenic
1034254600 7:149717649-149717671 GGCCTCAGGCAGGCAGTCACGGG + Intronic
1035431921 7:158829100-158829122 GGTCGCAGGCGCGCACCCCCAGG + Exonic
1037611953 8:20483300-20483322 GGTGGCAGGCAGGGAGGCAGGGG + Intergenic
1040308283 8:46223526-46223548 GGTCGCAGGAACTCAGGGAAAGG + Intergenic
1041244846 8:55880131-55880153 GGGCGCGGGCACGCGGGCAGTGG + Intronic
1044751912 8:95424174-95424196 GGTCCCAGGCCCTCAGGCAAAGG + Intergenic
1048971539 8:139647672-139647694 GGTCACAGGGACCCAGCCACAGG + Intronic
1049245554 8:141560412-141560434 GGACACAGGGAGGCAGGCACTGG + Intergenic
1049521673 8:143094665-143094687 GGTCGGATGCCCGCAGGCACTGG + Intergenic
1057448962 9:95139321-95139343 CCTCACAGGCAGGCAGGCACTGG + Intronic
1059756280 9:117296737-117296759 GGTGGGAGGGAGGCAGGCACTGG - Intronic
1062460570 9:136661012-136661034 GGCCGCAGGGATGCAGGCAGAGG + Intronic
1062695546 9:137874063-137874085 GGTCGCACGATTGCAGGCACAGG - Intergenic
1062696961 9:137880483-137880505 GGTCAGAGGGACGCAGGCCCAGG + Intronic
1187477841 X:19627455-19627477 GGTGGCAGGAACACAGACACGGG + Intronic
1188683499 X:33041286-33041308 GGTCGCCGGCGCGCATGCGCAGG - Intronic
1189473952 X:41334742-41334764 GCTCGCAGGCACGCAAACACCGG - Intronic
1198715233 X:139551548-139551570 GGTCGCAGGTACTCAGGTTCAGG + Intronic