ID: 1062971878

View in Genome Browser
Species Human (GRCh38)
Location 10:1654517-1654539
Sequence CACACTGCACAGGTGGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 259}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062971878_1062971887 8 Left 1062971878 10:1654517-1654539 CCTCTTTCCACCTGTGCAGTGTG 0: 1
1: 1
2: 0
3: 27
4: 259
Right 1062971887 10:1654548-1654570 TCCCCGCAGGGTGGCAGTTCAGG No data
1062971878_1062971889 9 Left 1062971878 10:1654517-1654539 CCTCTTTCCACCTGTGCAGTGTG 0: 1
1: 1
2: 0
3: 27
4: 259
Right 1062971889 10:1654549-1654571 CCCCGCAGGGTGGCAGTTCAGGG No data
1062971878_1062971883 -1 Left 1062971878 10:1654517-1654539 CCTCTTTCCACCTGTGCAGTGTG 0: 1
1: 1
2: 0
3: 27
4: 259
Right 1062971883 10:1654539-1654561 GCCCCAGCTTCCCCGCAGGGTGG No data
1062971878_1062971881 -5 Left 1062971878 10:1654517-1654539 CCTCTTTCCACCTGTGCAGTGTG 0: 1
1: 1
2: 0
3: 27
4: 259
Right 1062971881 10:1654535-1654557 GTGTGCCCCAGCTTCCCCGCAGG No data
1062971878_1062971882 -4 Left 1062971878 10:1654517-1654539 CCTCTTTCCACCTGTGCAGTGTG 0: 1
1: 1
2: 0
3: 27
4: 259
Right 1062971882 10:1654536-1654558 TGTGCCCCAGCTTCCCCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062971878 Original CRISPR CACACTGCACAGGTGGAAAG AGG (reversed) Intronic
900150319 1:1175946-1175968 GACGCTGTGCAGGTGGAAAGAGG + Intronic
900150375 1:1176326-1176348 GACACTGTGCAGGTGGAGAGAGG + Intronic
900860360 1:5224691-5224713 CACATTCCACAGCTGGGAAGGGG + Intergenic
900889108 1:5436577-5436599 CACACTCCACAGGTGCAAGGGGG - Intergenic
901269037 1:7936125-7936147 CACTGTGCCCAGCTGGAAAGTGG - Intronic
901908411 1:12434334-12434356 CACCCTTCACAGCTGGCAAGTGG - Intronic
904117784 1:28175236-28175258 CAATCTGCAAAGGAGGAAAGTGG + Intronic
906650534 1:47509328-47509350 CACACACCACAGGTGGTCAGCGG - Intergenic
906821202 1:48932066-48932088 CATACTGCTCAGGTGGAGAGAGG - Intronic
907377441 1:54055252-54055274 CACTGTGCCCAGCTGGAAAGAGG + Intronic
907623504 1:56006336-56006358 GACACTGTACAGGTGAGAAGGGG - Intergenic
910676603 1:89821763-89821785 CACCCTGCACAGGAAGGAAGCGG - Intronic
910711811 1:90189896-90189918 CCCACTGCAGAGAGGGAAAGAGG - Intergenic
912221076 1:107676206-107676228 CTCACTTCTCAGGTGGGAAGTGG - Intronic
913317965 1:117568174-117568196 CACCCTGCACAGCTGCCAAGGGG - Intergenic
913672793 1:121113719-121113741 AACACTGCACATGTAGAAATGGG - Intergenic
914024569 1:143901093-143901115 AACACTGCACATGTAGAAATGGG - Intergenic
914321390 1:146565375-146565397 AACACTGCCCAGGAGGTAAGAGG - Intergenic
914322520 1:146578870-146578892 AAGAGTGCACAGGTGGAATGTGG - Intergenic
914663054 1:149809114-149809136 AACACTGCACATGTAGAAATGGG - Intronic
915007930 1:152657378-152657400 CTCACTGCACATTTGGAAATGGG - Intergenic
915130773 1:153693892-153693914 CACAGTGCACAGGGGAGAAGAGG + Exonic
915215940 1:154340835-154340857 CACACTGCACAGGGGACAAGAGG - Exonic
917196089 1:172467207-172467229 AACACAGCACAGGTGGAAGGTGG - Intronic
918708840 1:187703256-187703278 CATAGTGCACAGGTGGATGGGGG - Intergenic
921908596 1:220523537-220523559 CCTAGTGCACAGGTGGATAGGGG + Intergenic
922506463 1:226128843-226128865 CACACAGGACAGCTGGAGAGGGG + Intergenic
1062971878 10:1654517-1654539 CACACTGCACAGGTGGAAAGAGG - Intronic
1063146330 10:3298180-3298202 CAGACAGCAGAGGTGGAAATGGG + Intergenic
1063958905 10:11290245-11290267 CCCACTGAACAAGGGGAAAGGGG + Intronic
1064388737 10:14922731-14922753 CACACTGCACTGTTAGTAAGTGG + Intronic
1065176106 10:23076953-23076975 CACACTGTGCAAGAGGAAAGTGG + Intergenic
1067764518 10:49075083-49075105 CACTGTGCACAGGTGCAAATGGG + Intronic
1067824422 10:49559694-49559716 CACATTGCACATGTGAAAAGAGG + Intergenic
1068892362 10:62160982-62161004 CACTCTCCACAGATGGACAGTGG - Intergenic
1070383230 10:75900579-75900601 TGCACTGCACAGGCTGAAAGTGG - Intronic
1072011695 10:91307468-91307490 CACACAGCACAGGAGGAATGAGG + Intergenic
1072147353 10:92653709-92653731 CACACTGGAGAGGTCTAAAGTGG + Exonic
1073228231 10:101943067-101943089 CACACTGCAGGGTTGGGAAGAGG + Intronic
1073379745 10:103068910-103068932 CAAACTGAACACGTGTAAAGTGG + Intronic
1074064986 10:110006693-110006715 CACACTTCATATGTGGGAAGAGG + Intronic
1074365374 10:112853564-112853586 CACATTCCACAGGTGGCCAGTGG + Intergenic
1075201467 10:120408269-120408291 AACACAGCACAGGTGGGAGGAGG - Intergenic
1076332436 10:129680363-129680385 CCCACTGCAGCGCTGGAAAGGGG - Intronic
1077134935 11:993783-993805 GACGCTGCACAGGTGGAACTTGG - Exonic
1077987322 11:7366280-7366302 AAGACTGCATAGGTAGAAAGGGG - Intronic
1078534106 11:12159798-12159820 AACATTGCACATGGGGAAAGTGG + Intronic
1079115536 11:17638464-17638486 CACACTGCACTTGGGGACAGCGG - Exonic
1079380803 11:19935534-19935556 AACACAGCTCAGGAGGAAAGAGG - Intronic
1081661805 11:44892998-44893020 CACACAGCACAGCTAGAACGAGG - Intronic
1083105530 11:60354806-60354828 TACACTGCACAGGTGTACACAGG - Intronic
1085760154 11:79234607-79234629 CACTCTGCAGAGGTGGAAGAAGG - Intronic
1085836192 11:79959316-79959338 CACGCTTCACAGATCGAAAGTGG - Intergenic
1086007524 11:82055490-82055512 CACACTGCTGTGGTGGAAATAGG + Intergenic
1086802774 11:91197637-91197659 CAGAATGCACAAGAGGAAAGTGG - Intergenic
1086887635 11:92223944-92223966 CACACTGCCCCGGTGGAGAGGGG - Intergenic
1087780031 11:102291897-102291919 GACAGTGCACAAGTGGATAGTGG - Intergenic
1089504416 11:118953976-118953998 ACCACTGCACAAATGGAAAGAGG - Intronic
1090354099 11:126128029-126128051 CCCACAGCTCAGGTGGAGAGAGG - Intergenic
1091330968 11:134730565-134730587 CACCCAGCACACCTGGAAAGAGG - Intergenic
1097322234 12:58238692-58238714 CACGTTGCAAAAGTGGAAAGGGG + Intergenic
1097380989 12:58895516-58895538 CAGAGTGCACGGGTGGAGAGTGG + Intronic
1099139153 12:78948767-78948789 CACAGTGCACAGGAAGAAAATGG - Intronic
1101210063 12:102526507-102526529 CTGACTGCACAGCTGGAAGGTGG - Intergenic
1103923892 12:124413264-124413286 CACGCTGCAGAGGTGGACACAGG - Intronic
1104191930 12:126490325-126490347 CATACTGCACAGCTGGAAACAGG + Intergenic
1104647807 12:130509479-130509501 CACATAGCACAGGTGGCAAAGGG - Intronic
1110496777 13:76177015-76177037 TACACAGTACAGGTGGAAAGTGG - Intergenic
1110524335 13:76518282-76518304 AACTCTGCACGGCTGGAAAGTGG - Intergenic
1110881425 13:80577447-80577469 CCAACTGCACAAGTGGGAAGGGG + Intergenic
1112212155 13:97388555-97388577 CCCACAGGACAGGAGGAAAGTGG - Intronic
1113457892 13:110461934-110461956 CACACTGGACAGCTGGATGGGGG + Intronic
1113883304 13:113641647-113641669 CACCCTGAAAAGGTGGAAGGTGG + Intergenic
1114406806 14:22464364-22464386 CATGCTGCACATGGGGAAAGGGG + Intergenic
1114449425 14:22815247-22815269 GACACTGCACAGCAGCAAAGAGG + Intronic
1115635577 14:35287547-35287569 CACAAGGCAAAGGTAGAAAGTGG - Intronic
1116647612 14:47549396-47549418 CACACTGGAATGGTGGAAAAAGG - Intronic
1117620811 14:57584886-57584908 CACACTGTACAGGTGCACATAGG + Intronic
1117931689 14:60849659-60849681 CACTAAGCACAGGTGGACAGTGG + Intronic
1118635867 14:67748344-67748366 CCCACTCCACTGGAGGAAAGAGG + Exonic
1120010919 14:79413348-79413370 CAAACAGCACAGATGGAAGGAGG - Intronic
1121504321 14:94464844-94464866 CCTACTCCACAGGTGGATAGAGG - Exonic
1122595236 14:102885800-102885822 CTCACAGCACAGGTGGACAGTGG - Intronic
1122972567 14:105158357-105158379 CACACAGAACAGGTGGCAGGAGG + Intronic
1123146503 14:106135876-106135898 CACATTGCAAGGGTGGAATGAGG - Intergenic
1124090921 15:26599249-26599271 CACATTCCAGAGATGGAAAGGGG + Intronic
1125403295 15:39327322-39327344 CCAACTGCACAGATGAAAAGGGG - Intergenic
1126028759 15:44475315-44475337 CACACTGCATTGGTTGAAAAGGG - Intronic
1126112589 15:45184599-45184621 CACACTGCACAGATGGTCACAGG + Intronic
1127199534 15:56628888-56628910 AACACTGAAGAGATGGAAAGGGG + Intergenic
1128135511 15:65260340-65260362 CACACTGCAGAGATGGAACTAGG + Intronic
1129404670 15:75308132-75308154 CACACCGCTCAGCTGGGAAGTGG - Intergenic
1129625976 15:77200067-77200089 GAGACTGAACAGGTGGAAATAGG - Intronic
1132279958 15:100603518-100603540 CACACTGTACAGAAAGAAAGTGG - Intronic
1135136199 16:19886406-19886428 CAGACTGCGCAATTGGAAAGTGG + Intergenic
1136068159 16:27772336-27772358 AAGGCTGCACAGGTGGGAAGGGG + Intronic
1136536229 16:30901408-30901430 CAAACTGCACAGCTAGTAAGTGG + Intronic
1136692561 16:32045632-32045654 CACATTGCAAGGGTGGAATGAGG + Intergenic
1136793057 16:32988858-32988880 CACATTGCAAGGGTGGAATGAGG + Intergenic
1136876796 16:33865199-33865221 CACATTGCAAGGGTGGAATGAGG - Intergenic
1136932219 16:34429236-34429258 CCAACTGCAGAGGTGGAAAAGGG + Intergenic
1136972353 16:34982578-34982600 CCAACTGCAGAGGTGGAAAAGGG - Intergenic
1139309502 16:66016453-66016475 CACCCAGCACAGGTAGTAAGGGG + Intergenic
1139444761 16:66990351-66990373 CACAATGAAAAGGTGAAAAGAGG - Intronic
1140011103 16:71132305-71132327 AAGAGTGCACAGGTGGAATGTGG + Intronic
1140012237 16:71145771-71145793 AACACTGCCCAGGAGGTAAGAGG + Intronic
1140238387 16:73179584-73179606 CAAACTGCTCACGTGGAAATTGG + Intergenic
1141371145 16:83487374-83487396 GATAGTGCACATGTGGAAAGTGG - Intronic
1141734255 16:85841581-85841603 CCCATTGGACAGGTGGGAAGAGG - Intergenic
1203095314 16_KI270728v1_random:1250549-1250571 CACATTGCAAGGGTGGAATGAGG + Intergenic
1142755751 17:2015486-2015508 CACATTGGAGAGGTGGCAAGAGG + Intronic
1143085356 17:4412129-4412151 CACACATCAAAGGTGGAAATGGG - Intergenic
1143177355 17:4963743-4963765 CACCGTGCCCAGCTGGAAAGGGG + Intronic
1144408661 17:14977328-14977350 AATACTGCAGAGGTGGAATGAGG + Intergenic
1145828915 17:27899082-27899104 TAGAATGAACAGGTGGAAAGGGG - Intergenic
1146925701 17:36743305-36743327 CACACTGCAAGGGTGGATGGAGG + Intergenic
1148834667 17:50459752-50459774 TTCAGTGCACAGGTGGAAACAGG - Intronic
1149654387 17:58302604-58302626 CACACAGCACAGGTGGTGAATGG + Intronic
1150008542 17:61485093-61485115 CACACTTCACAGTTGTAAAATGG - Intronic
1153400357 18:4678440-4678462 CACACTGCAGAAGTGGGAAAGGG + Intergenic
1154435959 18:14341681-14341703 CACACTGCAGAGCTGGAGTGGGG - Intergenic
1155335624 18:24762725-24762747 CTAACTGCAGAGATGGAAAGTGG - Intergenic
1156669926 18:39455859-39455881 TCCACTGCACAGGTGAAAGGGGG + Intergenic
1157583656 18:48787705-48787727 CAGACTGCACAGGCAGACAGAGG - Intronic
1160239755 18:77114797-77114819 CGCACCGCACACTTGGAAAGGGG - Intronic
1160696204 19:485787-485809 CACACGGCACAGCAGGAGAGGGG + Intergenic
1161415861 19:4145932-4145954 CATTCTGCACAGGAGGACAGAGG - Intergenic
1162081852 19:8222831-8222853 CTCACAGCACAGGTGGAAGACGG + Intronic
1166443066 19:42833157-42833179 TACACTGCAGATGAGGAAAGAGG + Intronic
1166450848 19:42899571-42899593 TACACTGCAGATGAGGAAAGAGG + Intronic
1166480042 19:43163895-43163917 TACACTGCAGAAGAGGAAAGAGG + Intronic
1166489861 19:43249426-43249448 TACACTGCAGATGAGGAAAGAGG + Intronic
1167014409 19:46831108-46831130 CAAACAGCACAGGAGGAAAATGG + Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1168501754 19:56899002-56899024 TACACTGCACAGGCTGAGAGTGG + Intergenic
925338494 2:3115934-3115956 CACACGGCACAGGCACAAAGAGG - Intergenic
925714465 2:6771917-6771939 CACACTGCTCACCTGGAGAGAGG + Intergenic
927277358 2:21273205-21273227 CACACTGCACACGTGGCAGTGGG - Intergenic
929443004 2:41980311-41980333 CACACAGCACGGAAGGAAAGAGG - Intergenic
931055856 2:58470322-58470344 GAAACTGGACAGGTGGAAAAGGG - Intergenic
931994614 2:67828045-67828067 CACAGAGCAGGGGTGGAAAGTGG - Intergenic
932693738 2:73936242-73936264 CACACTGGTCAGGTGCGAAGTGG - Intronic
933635529 2:84704637-84704659 AACACTGCTCAGTTGGATAGTGG + Intronic
933718042 2:85376504-85376526 CACATTGCAGAGGAGGCAAGGGG + Intronic
934962645 2:98690403-98690425 AACCCTGCACAGCTGGAAGGAGG + Intronic
937876928 2:126832877-126832899 AACTCTTCAGAGGTGGAAAGAGG + Intergenic
938267564 2:129939337-129939359 CTCTCTGCACAGATGGACAGGGG + Intergenic
939254959 2:139731045-139731067 CAAACTGCACAGCTAGAAAGTGG + Intergenic
940705858 2:157104348-157104370 TACAATGCACAGGTGGACACTGG + Intergenic
942264705 2:174211021-174211043 CACACTCCTGAGGTGGAAGGAGG + Intronic
942928568 2:181461486-181461508 CAGAGTGCCCGGGTGGAAAGTGG - Intronic
944518623 2:200540353-200540375 GACACTACACTGGTGGTAAGGGG + Intronic
946858807 2:223980198-223980220 CACACTGCCTGGCTGGAAAGAGG + Intronic
1169539561 20:6584135-6584157 CAAACTGCTCCGGTTGAAAGGGG + Intergenic
1171328009 20:24312783-24312805 CACCTTGCAGAGGAGGAAAGCGG - Intergenic
1172293809 20:33793824-33793846 CACACTTCAATCGTGGAAAGTGG - Intergenic
1173125679 20:40333740-40333762 CACACTGTACAGGTGATCAGAGG - Intergenic
1174330195 20:49811940-49811962 CACACTTCAGAGGGGAAAAGGGG + Intergenic
1176424158 21:6537701-6537723 GACACTGCACAGCTGGCAAGAGG - Intergenic
1177491876 21:21836447-21836469 CAAAATGCAAGGGTGGAAAGTGG - Intergenic
1178514132 21:33231197-33231219 AAGCCTGCACAGGTGGATAGGGG - Intronic
1178642591 21:34357088-34357110 GACTCTGCACAGGTTGAACGTGG - Intergenic
1179626560 21:42652764-42652786 GACACTTAACAGATGGAAAGCGG + Intergenic
1179699651 21:43146016-43146038 GACACTGCACAGCTGGCAAGAGG - Intergenic
1180976690 22:19852535-19852557 CCCACTGGACTGGTGGGAAGAGG + Intronic
1181362976 22:22352974-22352996 CTCACTGCACAGGTAGGAAAAGG + Intergenic
1182250682 22:28997554-28997576 CACACTCCTCAGATGGAGAGAGG - Intronic
1182753984 22:32663939-32663961 CACACTGCACATTTTGAAAAAGG + Intronic
1183143833 22:35971083-35971105 CACTCTGCACAGCTTAAAAGAGG - Intronic
1184608274 22:45586705-45586727 CACACTGAGCAGGTGAAAGGTGG + Intronic
1184819313 22:46897202-46897224 CACACTCCACAGGTCGGGAGTGG + Intronic
1184935026 22:47714724-47714746 CACACTGCATGGGTGGGAAGGGG + Intergenic
1185418802 22:50723750-50723772 AACACTGCACTGCTGGGAAGAGG - Intergenic
949478991 3:4475330-4475352 CACCCAGCACAGGTAGTAAGGGG - Intergenic
950180624 3:10910709-10910731 CAAACCACACAGCTGGAAAGTGG - Intronic
950667421 3:14505849-14505871 CACTCAGCACAGCTGGAAATGGG - Intronic
952737479 3:36704873-36704895 CAAACAACTCAGGTGGAAAGAGG - Intergenic
953542579 3:43835060-43835082 CACATTGCACAGGAAGCAAGTGG - Intergenic
954762930 3:52890112-52890134 CACACTGGAGAGGGGGAATGAGG - Intronic
956018921 3:64913073-64913095 TACACTTCACAGCTGGCAAGAGG - Intergenic
962308857 3:134312069-134312091 CAGAGTGCCCAGGTGGCAAGTGG - Intergenic
962422381 3:135239966-135239988 CCCGCCGCACAGGTAGAAAGAGG + Intronic
962747120 3:138405085-138405107 CAAAGTGCACAGGTAGTAAGTGG - Exonic
966906827 3:184532288-184532310 CAGACAGCACAGGCTGAAAGAGG - Intronic
968232071 3:197010108-197010130 CTCACTACCCAGGAGGAAAGTGG + Intronic
968474790 4:799111-799133 TGCCCTGCACAGGTGAAAAGAGG - Intronic
969698825 4:8754360-8754382 CATACTCCACAGGGTGAAAGCGG + Intergenic
969871574 4:10107968-10107990 CTCAGTGCACAGGTGGGAGGTGG - Intronic
970416075 4:15858180-15858202 CACAGTGGGCAGCTGGAAAGGGG - Intergenic
970456422 4:16227336-16227358 CACACGCCAGAGCTGGAAAGGGG - Intronic
970526897 4:16942009-16942031 CCCACTGTACAGCTGGAAAAGGG - Intergenic
971055106 4:22903631-22903653 CACAATTCACAGGTGGACAGTGG + Intergenic
971191685 4:24434649-24434671 ATCACAGAACAGGTGGAAAGGGG - Intergenic
972294445 4:37723197-37723219 GACACTGGAGAGGTGGATAGGGG - Intergenic
977089629 4:92653970-92653992 TACACTTCATATGTGGAAAGAGG + Intronic
979293236 4:119001157-119001179 GACACTGCACAGGTTCAAGGGGG - Intronic
980282346 4:130737624-130737646 CACCCAGCACAGATGGAGAGTGG - Intergenic
981082890 4:140652616-140652638 CAAGCTGCACAGCTAGAAAGTGG - Intronic
981560151 4:146039528-146039550 CACACTGCACTGGTTTAAAATGG - Intergenic
982023398 4:151227987-151228009 CAGTCTGCACAGCTGGAATGTGG + Intronic
982630429 4:157823702-157823724 CAAACTGCAGAAGTGGAAAAGGG + Intergenic
985805128 5:2038306-2038328 AACACTGCACTGTTGAAAAGCGG + Intergenic
985819878 5:2152436-2152458 CTCACTGCACAGATGGAAGATGG + Intergenic
985819881 5:2152471-2152493 CTCACTGCACAGATGGAAGATGG + Intergenic
985819884 5:2152506-2152528 CTCACTGCACAGATGGAAGATGG + Intergenic
985819887 5:2152541-2152563 CTCACTGCACAGATGGAAGATGG + Intergenic
985819890 5:2152576-2152598 CTCACTGCACAGATGGAAGATGG + Intergenic
986599470 5:9457311-9457333 CACTCTGCACAGGTAGAAATTGG - Intronic
986731018 5:10635134-10635156 CACTTTGAACAGGTGGAAAGAGG - Intronic
987394007 5:17403897-17403919 CAGACTGCACAGATGGAACATGG + Intergenic
989760060 5:45004190-45004212 CACACTGAACAGTTGAAAATTGG + Intergenic
990986966 5:61649582-61649604 CAGAGTGCACAGGGGGAAGGTGG - Intronic
991653090 5:68876033-68876055 CACATGGTAGAGGTGGAAAGGGG - Intergenic
992552670 5:77874118-77874140 CCCACTGCACTGATGGAAATGGG - Intergenic
993165474 5:84348429-84348451 TGCACAGCACAGGTGGAAAAAGG - Intronic
993321671 5:86477404-86477426 TACACTCCACAGGGGGAGAGCGG + Intergenic
995174960 5:109165565-109165587 CACACCACACAGGTGGGAGGAGG + Intronic
997516276 5:134492071-134492093 CAGACTACACAGGTGCCAAGGGG - Intergenic
999625262 5:153513784-153513806 CAGGTTGCACAGGTGTAAAGTGG - Intronic
1001120554 5:168976636-168976658 CACACAGCACAGGAGGAACAAGG - Intronic
1001973250 5:175974165-175974187 AGCACTGCATAGGTAGAAAGGGG + Intronic
1002244187 5:177869618-177869640 AGCACTGCATAGGTAGAAAGGGG - Intergenic
1002276792 5:178109145-178109167 CACACTGCTCAGATGCCAAGGGG - Intergenic
1003689319 6:8337119-8337141 CAGGATGCACCGGTGGAAAGAGG - Intergenic
1004146728 6:13074405-13074427 CATACAGCACTGGTGGAAAGAGG + Intronic
1004564050 6:16779238-16779260 CACTCTGAAGAGATGGAAAGAGG - Intergenic
1006517433 6:34552830-34552852 GACACTTCACAGGTGGGAACCGG - Intronic
1007252982 6:40509017-40509039 CAGACCTCACAGGTGGAAGGAGG - Intronic
1007746051 6:44043593-44043615 CACATCACACAGCTGGAAAGTGG + Intergenic
1008156307 6:48019195-48019217 CACACAGCACAGGTGGAAAGAGG + Intronic
1011899039 6:92269262-92269284 CACACTGCTCAAGTAGAAAAAGG - Intergenic
1012155404 6:95813339-95813361 CACACTGGCCAGGTGGAAGTGGG + Intergenic
1013343150 6:109235244-109235266 GATAATGCCCAGGTGGAAAGTGG - Intergenic
1018424548 6:163668599-163668621 CATACTGCCCAGATGGAAAGGGG - Intergenic
1018483353 6:164214297-164214319 GACACTCCACAGGAGGAAAGGGG - Intergenic
1019516140 7:1440980-1441002 CCCCTTGCACAGGTGGACAGAGG - Intronic
1020422050 7:8018497-8018519 CCCACTGCACAGGACTAAAGAGG - Intronic
1020618296 7:10487664-10487686 CACACTGCATAGTTAGAAAATGG - Intergenic
1020855489 7:13416316-13416338 CAAACTTCAAAGATGGAAAGTGG + Intergenic
1022945285 7:35278112-35278134 AACCCAGCACAGGTGAAAAGAGG + Intergenic
1023043310 7:36191378-36191400 CACACTGGAGAGGTGGGAAGAGG + Intronic
1023478449 7:40606391-40606413 CCCACTACACAGATGGAAACAGG + Intronic
1023558761 7:41450544-41450566 CACACTGGACAGGGTGAAGGCGG + Intergenic
1023966886 7:44967425-44967447 CCCACTGCACAGGTGAGATGTGG - Intronic
1025772678 7:64527984-64528006 CAAACTGCAGAAGTGGAAAAGGG + Intronic
1025988160 7:66474102-66474124 CACACGCCAGAGCTGGAAAGGGG + Intergenic
1026023462 7:66728021-66728043 TACACTGGAAAGGTGGAAGGGGG - Intronic
1027211142 7:76150000-76150022 CACACGCCAGAGCTGGAAAGGGG + Intergenic
1028504821 7:91559325-91559347 CACACAGCACAGGTGCTATGTGG + Intergenic
1029206895 7:98874965-98874987 CACACTGCACATGGGGCTAGTGG + Intergenic
1029490546 7:100867892-100867914 AACACTGCTCAGATGGAAGGGGG - Exonic
1030463892 7:109875504-109875526 AACCCTGCACAAGTGGTAAGTGG + Intergenic
1033234308 7:139626022-139626044 CACACTGAAAAGGAGGGAAGAGG - Intronic
1033314460 7:140285981-140286003 CACACTGCACACATGGGAATGGG - Intergenic
1034610306 7:152361112-152361134 CAAACTTCACAGGGGGAAAGGGG + Intronic
1034653573 7:152711785-152711807 CACACTGCACAGGGTGGGAGCGG - Intergenic
1035042857 7:155943349-155943371 AACACTTCCCAGGTGGAAGGAGG - Intergenic
1037483252 8:19324691-19324713 CACACTGCACTGGTGGTTTGTGG + Intronic
1039307714 8:36280908-36280930 CTCATTGAACAGCTGGAAAGAGG - Intergenic
1040362898 8:46684256-46684278 CACACTGCAGAGTTGGCAAAGGG + Intergenic
1040837672 8:51749401-51749423 CACACTGCACAGGTGTGAATGGG - Intronic
1041661646 8:60406936-60406958 GAGAATGCAGAGGTGGAAAGAGG - Intergenic
1041863646 8:62542996-62543018 GACACTGAAGTGGTGGAAAGAGG + Intronic
1045472934 8:102528475-102528497 CAAACCGCACAGCTGGTAAGTGG + Intergenic
1046224030 8:111253122-111253144 CACACTGCAGAAGTGGACACTGG + Intergenic
1047695335 8:127397725-127397747 CACACTCAACAGTTAGAAAGGGG + Intergenic
1048268094 8:133005213-133005235 CACACTGCGCAGGAGGTGAGAGG + Intronic
1049227986 8:141466800-141466822 CACACTGCCCAGGTAGACACTGG + Intergenic
1049306442 8:141906743-141906765 CACACGGAGCAGGTGGAAGGCGG - Intergenic
1049758704 8:144322168-144322190 CATACTGCACAGGTGGAAGAGGG + Intronic
1051360823 9:16280223-16280245 CAGATTGCACAGCTGGAAAGAGG + Intergenic
1051677972 9:19577749-19577771 CACAATTCACAGTTGCAAAGTGG + Intronic
1051692058 9:19725274-19725296 CACACTGTACATCTGGTAAGTGG + Intronic
1053138644 9:35667949-35667971 CACAGTGGAGTGGTGGAAAGAGG - Intronic
1057767795 9:97938326-97938348 CACACTGCACAGGTGTGAGTAGG + Exonic
1058879704 9:109275604-109275626 CACACTGCCCAGCTACAAAGAGG + Intronic
1059831965 9:118106239-118106261 CACACTGAACGTGAGGAAAGTGG + Intergenic
1059856322 9:118401632-118401654 CACATTGCCCAGGAAGAAAGAGG - Intergenic
1060021731 9:120137347-120137369 CACACTGCAAATGAGGAAAGAGG - Intergenic
1060889679 9:127179961-127179983 CATTCTGCAGGGGTGGAAAGTGG - Intronic
1061488755 9:130933852-130933874 CACACTCCACAGATGAAAGGAGG + Intronic
1062133479 9:134912758-134912780 CAGACTCCACAGGATGAAAGAGG + Intronic
1062193745 9:135261123-135261145 CCCAGTGCACGTGTGGAAAGGGG - Intergenic
1193571082 X:83144424-83144446 CATACTGCACAGCTAGCAAGTGG - Intergenic
1194910301 X:99633078-99633100 CATACTGAACAGGTGAAAAGTGG - Intergenic
1196887007 X:120256097-120256119 CACACTGCGAAGGTATAAAGTGG - Exonic
1197563954 X:128057938-128057960 TACATGGCACAAGTGGAAAGGGG - Intergenic
1198525174 X:137493366-137493388 CACAGAGCTCAGGTGGCAAGTGG + Intergenic