ID: 1062974564

View in Genome Browser
Species Human (GRCh38)
Location 10:1674067-1674089
Sequence AGGTCTGACATCGACTTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 61}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062974564_1062974578 20 Left 1062974564 10:1674067-1674089 CCCCTGAAGTCGATGTCAGACCT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1062974578 10:1674110-1674132 TGGGAACGGCCCCGTCGGCCGGG No data
1062974564_1062974569 -10 Left 1062974564 10:1674067-1674089 CCCCTGAAGTCGATGTCAGACCT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1062974569 10:1674080-1674102 TGTCAGACCTGAGGGCTGCAAGG No data
1062974564_1062974570 -7 Left 1062974564 10:1674067-1674089 CCCCTGAAGTCGATGTCAGACCT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1062974570 10:1674083-1674105 CAGACCTGAGGGCTGCAAGGAGG No data
1062974564_1062974574 6 Left 1062974564 10:1674067-1674089 CCCCTGAAGTCGATGTCAGACCT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1062974574 10:1674096-1674118 TGCAAGGAGGCCACTGGGAACGG No data
1062974564_1062974577 19 Left 1062974564 10:1674067-1674089 CCCCTGAAGTCGATGTCAGACCT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1062974577 10:1674109-1674131 CTGGGAACGGCCCCGTCGGCCGG No data
1062974564_1062974575 15 Left 1062974564 10:1674067-1674089 CCCCTGAAGTCGATGTCAGACCT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1062974575 10:1674105-1674127 GCCACTGGGAACGGCCCCGTCGG No data
1062974564_1062974572 0 Left 1062974564 10:1674067-1674089 CCCCTGAAGTCGATGTCAGACCT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1062974572 10:1674090-1674112 GAGGGCTGCAAGGAGGCCACTGG No data
1062974564_1062974580 22 Left 1062974564 10:1674067-1674089 CCCCTGAAGTCGATGTCAGACCT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1062974580 10:1674112-1674134 GGAACGGCCCCGTCGGCCGGGGG No data
1062974564_1062974579 21 Left 1062974564 10:1674067-1674089 CCCCTGAAGTCGATGTCAGACCT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1062974579 10:1674111-1674133 GGGAACGGCCCCGTCGGCCGGGG No data
1062974564_1062974581 28 Left 1062974564 10:1674067-1674089 CCCCTGAAGTCGATGTCAGACCT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1062974581 10:1674118-1674140 GCCCCGTCGGCCGGGGGCCCAGG No data
1062974564_1062974573 1 Left 1062974564 10:1674067-1674089 CCCCTGAAGTCGATGTCAGACCT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1062974573 10:1674091-1674113 AGGGCTGCAAGGAGGCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062974564 Original CRISPR AGGTCTGACATCGACTTCAG GGG (reversed) Intronic
918827644 1:189346330-189346352 AAGTCTGAAATGGACTTCACTGG + Intergenic
919892867 1:201988698-201988720 AAGTATGACATCCACTTCACAGG - Intronic
924430744 1:243994525-243994547 AGGTCTCACATCCACTTCTTGGG + Intergenic
1062974564 10:1674067-1674089 AGGTCTGACATCGACTTCAGGGG - Intronic
1066495115 10:35934965-35934987 TGGTCTGACAGCGCCTACAGTGG - Intergenic
1072347167 10:94519600-94519622 AAGTCTGAAATAGACTTCACTGG + Intronic
1084146362 11:67267116-67267138 GGGGCTGACAGCGACTTCGGGGG - Intronic
1084781481 11:71412509-71412531 AAGTCTGAAATGGATTTCAGTGG - Intergenic
1086278449 11:85159151-85159173 TGAACTGACATCGATTTCAGGGG + Intronic
1089737585 11:120560830-120560852 AGCTTTAACATCTACTTCAGTGG + Intronic
1091146584 11:133285327-133285349 AGGGCTGAAAAAGACTTCAGTGG - Intronic
1092343445 12:7695731-7695753 CGGTCTGACAGCCACTCCAGAGG - Exonic
1102349358 12:112180754-112180776 AGACCTGACATCGACTTTGGGGG + Intronic
1104586078 12:130048901-130048923 AGGTGTGTCATGGACTGCAGTGG + Intergenic
1115855681 14:37627187-37627209 AGATCTGGCATCGCCTTCTGGGG - Intronic
1118058939 14:62114935-62114957 AGGTCTCACAACCACTTTAGAGG + Intergenic
1119903035 14:78277482-78277504 AGGTCACACAGCTACTTCAGGGG - Intronic
1120668091 14:87331157-87331179 GAGTCTGACATTGACTTCTGGGG - Intergenic
1121066177 14:90968055-90968077 AAGTCTGACATGGACATCACTGG + Intronic
1122172348 14:99887405-99887427 AGTTCTGTCATGGGCTTCAGGGG + Intronic
1126788878 15:52202601-52202623 AGGGCTGAAATCTACTACAGAGG + Intronic
1159577447 18:70197090-70197112 AGGGCTGAAATGGACTCCAGTGG - Intronic
925122643 2:1431216-1431238 AGGTCTCACATGGACTTCCTGGG - Intronic
932196066 2:69785075-69785097 ATGTATGACATCGACTTCCTTGG - Intronic
932499940 2:72174387-72174409 AGGTGTGACATGGGGTTCAGGGG + Intergenic
943028494 2:182657398-182657420 AGGGCTGACATCATCTTCACTGG - Intergenic
944336868 2:198544212-198544234 AGGGCTGACATTTACTTCAAAGG + Intronic
946577911 2:221096221-221096243 AGGTATGAAATCTACTTCATGGG - Intergenic
948694679 2:239727227-239727249 AGGTCTGAGATAGACAGCAGAGG + Intergenic
1173264813 20:41469455-41469477 AGGTCTGCCTTTGCCTTCAGGGG + Intronic
1173970159 20:47146424-47146446 AGGTGCAACTTCGACTTCAGGGG - Intronic
1181963748 22:26642301-26642323 AGCTGTGACAAAGACTTCAGTGG + Intergenic
952042016 3:29272230-29272252 AGGTCTGGCATCAGCTTCTGGGG + Intergenic
960591951 3:119375223-119375245 AAGTCTGAAATCGGCTTCACTGG + Intronic
967501273 3:190200984-190201006 AGGTTTGACATAAACCTCAGGGG + Intergenic
968115438 3:196085772-196085794 ATGTCTGACAGCTAATTCAGGGG + Intergenic
968736014 4:2296936-2296958 AGGGCTGACAGAGCCTTCAGTGG - Intronic
971518185 4:27514767-27514789 AGGTATGACTTAAACTTCAGTGG - Intergenic
979026185 4:115579292-115579314 AAGTCTGATATCGGCTTCATTGG - Intergenic
981211200 4:142108010-142108032 AGGTCAGACATAGAGGTCAGTGG - Intronic
988782168 5:34532315-34532337 CACTCTGACATGGACTTCAGAGG + Intergenic
989293582 5:39797122-39797144 TGGGATGACATAGACTTCAGGGG + Intergenic
989699623 5:44247115-44247137 AGGCCTGACAATGACATCAGTGG + Intergenic
990817650 5:59803608-59803630 AGTTCTTACAACCACTTCAGGGG + Intronic
992873049 5:81025336-81025358 AGGCCAGACATCAACTTCGGAGG + Intronic
996846737 5:127907579-127907601 AAGTCTGACATCTATTTCAAAGG + Intergenic
997902215 5:137777546-137777568 AAGTCTGACACAGGCTTCAGTGG + Intergenic
1001450124 5:171818154-171818176 AGGTCTCACAGCTCCTTCAGGGG - Intergenic
1006393506 6:33772471-33772493 AGGTCTGCCATACTCTTCAGAGG - Exonic
1007868460 6:45003482-45003504 AGATCTGACTCCCACTTCAGGGG + Intronic
1008403351 6:51090424-51090446 AGGTCTGACATACAATTCATTGG - Intergenic
1011164304 6:84429149-84429171 AGGTCTGAAATAGGCTCCAGTGG - Intergenic
1019109512 6:169698653-169698675 ACGGCTGCCCTCGACTTCAGAGG - Intronic
1023163929 7:37324351-37324373 AGCTCTGACATCCACTTCTCCGG + Intronic
1040633671 8:49246674-49246696 ATGTCTGCCTTGGACTTCAGGGG - Intergenic
1044514752 8:93125087-93125109 GGGTCTGACATCCACTTGAGGGG + Intergenic
1046629863 8:116612704-116612726 AGGTCTGACACAGAGTTGAGGGG - Intergenic
1048284743 8:133133039-133133061 AGGTCTGACATCCCCTTTATGGG + Intronic
1056649258 9:88443907-88443929 AGGTCTGACAAAAACTCCAGGGG - Intronic
1057737754 9:97680810-97680832 AGGTCTGAAATCGACTTTCGGGG + Intronic
1186589127 X:10910118-10910140 ATATCTGAAATCAACTTCAGAGG + Intergenic
1187728147 X:22224998-22225020 AAGTCTGACATGGATCTCAGTGG + Intronic
1189030956 X:37449585-37449607 AGGTCCGACAACCATTTCAGAGG - Intronic
1190650300 X:52562951-52562973 AGGTGGGCCATGGACTTCAGGGG - Intergenic