ID: 1062974565

View in Genome Browser
Species Human (GRCh38)
Location 10:1674068-1674090
Sequence CAGGTCTGACATCGACTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 120}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062974565_1062974580 21 Left 1062974565 10:1674068-1674090 CCCTGAAGTCGATGTCAGACCTG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1062974580 10:1674112-1674134 GGAACGGCCCCGTCGGCCGGGGG No data
1062974565_1062974581 27 Left 1062974565 10:1674068-1674090 CCCTGAAGTCGATGTCAGACCTG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1062974581 10:1674118-1674140 GCCCCGTCGGCCGGGGGCCCAGG No data
1062974565_1062974579 20 Left 1062974565 10:1674068-1674090 CCCTGAAGTCGATGTCAGACCTG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1062974579 10:1674111-1674133 GGGAACGGCCCCGTCGGCCGGGG No data
1062974565_1062974577 18 Left 1062974565 10:1674068-1674090 CCCTGAAGTCGATGTCAGACCTG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1062974577 10:1674109-1674131 CTGGGAACGGCCCCGTCGGCCGG No data
1062974565_1062974575 14 Left 1062974565 10:1674068-1674090 CCCTGAAGTCGATGTCAGACCTG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1062974575 10:1674105-1674127 GCCACTGGGAACGGCCCCGTCGG No data
1062974565_1062974578 19 Left 1062974565 10:1674068-1674090 CCCTGAAGTCGATGTCAGACCTG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1062974578 10:1674110-1674132 TGGGAACGGCCCCGTCGGCCGGG No data
1062974565_1062974570 -8 Left 1062974565 10:1674068-1674090 CCCTGAAGTCGATGTCAGACCTG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1062974570 10:1674083-1674105 CAGACCTGAGGGCTGCAAGGAGG No data
1062974565_1062974572 -1 Left 1062974565 10:1674068-1674090 CCCTGAAGTCGATGTCAGACCTG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1062974572 10:1674090-1674112 GAGGGCTGCAAGGAGGCCACTGG No data
1062974565_1062974574 5 Left 1062974565 10:1674068-1674090 CCCTGAAGTCGATGTCAGACCTG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1062974574 10:1674096-1674118 TGCAAGGAGGCCACTGGGAACGG No data
1062974565_1062974573 0 Left 1062974565 10:1674068-1674090 CCCTGAAGTCGATGTCAGACCTG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1062974573 10:1674091-1674113 AGGGCTGCAAGGAGGCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062974565 Original CRISPR CAGGTCTGACATCGACTTCA GGG (reversed) Intronic
902816286 1:18918488-18918510 CAGGTCTGTCATGGGCTGCAGGG + Exonic
904666450 1:32125557-32125579 CAGGACTGACAGTGACTTCATGG - Intronic
906865433 1:49413322-49413344 CAGGTGTGACCTTGACCTCAAGG + Intronic
907800744 1:57762934-57762956 CATGTCTGACGTCTACGTCAGGG - Intronic
908419358 1:63944770-63944792 CAGCTCTGACACTGACATCATGG + Intronic
909966107 1:81912432-81912454 CAGTTCTGAAATAAACTTCAAGG - Intronic
911008406 1:93252870-93252892 CAGGTCTTACAAGGGCTTCAAGG + Intronic
911335418 1:96575104-96575126 CAGGTCACACATGGACTTGAAGG + Intergenic
912612882 1:111066557-111066579 CAGGTCACACATTGACTTGAAGG - Intergenic
913599538 1:120409927-120409949 CAGGTGTGGAATCAACTTCAGGG + Intergenic
914087843 1:144469688-144469710 CAGGTGTGGAATCAACTTCAGGG - Intergenic
914310770 1:146464517-146464539 CAGGTGTGGAATCAACTTCAGGG + Intergenic
914314408 1:146496210-146496232 CAGGTATGGAATCAACTTCAGGG - Intergenic
914379190 1:147101140-147101162 CAGGTGTGGAATCAACTTCAGGG - Intergenic
914499943 1:148237171-148237193 CAGGTATGGAATCAACTTCAGGG + Intergenic
914591335 1:149108630-149108652 CAGGTGTGGAATCAACTTCAGGG - Intergenic
916705149 1:167341798-167341820 CAGGTCACACATGGACTTGAAGG + Intronic
919656332 1:200200795-200200817 CAGGTCACACATGGACTTGAAGG - Intergenic
920850682 1:209626093-209626115 CAGGTCAGACCTCCTCTTCAGGG - Intronic
924430743 1:243994524-243994546 TAGGTCTCACATCCACTTCTTGG + Intergenic
924564301 1:245183724-245183746 CAGGTGTGAGATGGACTCCAGGG + Intronic
1062974565 10:1674068-1674090 CAGGTCTGACATCGACTTCAGGG - Intronic
1063005033 10:1962002-1962024 CAGCTCTGACATGGACTGGAAGG - Intergenic
1063210258 10:3874392-3874414 CAGCTCTGAAATAGATTTCAAGG + Intergenic
1063354277 10:5383232-5383254 CAGCTTTGACAAGGACTTCAAGG - Intergenic
1063541499 10:6938666-6938688 CAGTTCTGACACTGACTTCCTGG - Intergenic
1063789940 10:9433011-9433033 GATGTCTGACATTGACTTCTGGG + Intergenic
1064599367 10:16977590-16977612 CAGGTCACACATGGACTTGAAGG - Intronic
1068656027 10:59577318-59577340 CAGGTCACACATGGACTTGAAGG + Intergenic
1068665102 10:59665763-59665785 CAGCTCTGACAACGAAATCACGG - Intronic
1070743021 10:78914797-78914819 AAGGTCTGACGTCCACCTCAGGG + Intergenic
1073563834 10:104518974-104518996 CAGGTGTGTGATGGACTTCAAGG - Intergenic
1074947214 10:118292301-118292323 CATGTCTGACATGGTCTCCATGG + Intergenic
1078009738 11:7563582-7563604 CAGGCCTGACATCCAATTCCAGG - Intronic
1078742542 11:14080637-14080659 CAGGTCTGTCATGGAATTCATGG - Intronic
1085173968 11:74470838-74470860 CTAGTCTGACAGGGACTTCAAGG + Intergenic
1086278448 11:85159150-85159172 CTGAACTGACATCGATTTCAGGG + Intronic
1088450640 11:109977822-109977844 CAGGTCACACATGGACTTGAAGG - Intergenic
1094474998 12:30833956-30833978 CAGGTCACACATGGACTTGAAGG - Intergenic
1095463309 12:42464453-42464475 CAGGTCTGACAGACACTCCAGGG + Exonic
1097290842 12:57913726-57913748 CAGGTCACACATGGACTTGAAGG - Intergenic
1102349357 12:112180753-112180775 CAGACCTGACATCGACTTTGGGG + Intronic
1103666930 12:122575442-122575464 CAGGTCTTACATCAACCACATGG - Intronic
1104096796 12:125565529-125565551 CAGGTCACACATGGACTTGAAGG + Intronic
1106213564 13:27673657-27673679 CAGCCCTGACATGGACTTTACGG + Intergenic
1107563680 13:41580719-41580741 CACTTCTGACTTCCACTTCAGGG - Intronic
1109719745 13:66260472-66260494 CAGGTCACACATGGACTTAAAGG + Intergenic
1109801112 13:67379988-67380010 CAGGTCACACATGGACTCCAAGG - Intergenic
1110003249 13:70232800-70232822 CAGGTCATACATGGACTTGAAGG + Intergenic
1111668196 13:91296007-91296029 CAGGTCACACATGGACTTGAAGG - Intergenic
1111744003 13:92242512-92242534 CAGGTTTGAAATAAACTTCAAGG + Intronic
1112261494 13:97881965-97881987 CAGGTCACACATGGACTTGAAGG + Intergenic
1114380860 14:22202098-22202120 CAGGGCTCACATAGACTTCTTGG + Intergenic
1115855682 14:37627188-37627210 CAGATCTGGCATCGCCTTCTGGG - Intronic
1119719661 14:76882563-76882585 CAGGTCTGCCACCAGCTTCAGGG - Intergenic
1120685376 14:87531184-87531206 CAGGTCACACATGGACTTGAAGG - Intergenic
1122152501 14:99732543-99732565 CAGGCCTGACCTGGACTACAAGG + Intergenic
1126401354 15:48274129-48274151 CATTTCTGACATCAAGTTCATGG - Intronic
1131663921 15:94549299-94549321 CTTTTCTGACATCTACTTCATGG + Intergenic
1137462573 16:48678921-48678943 AAGGTATGACAACGACTTCAAGG - Intergenic
1137497934 16:48985188-48985210 CAGGTCCCACATGCACTTCAAGG + Intergenic
1139328034 16:66167031-66167053 CAGGTCACACATGGACTTGAAGG + Intergenic
1140836892 16:78803000-78803022 CAGGCCTGCCATGGAATTCATGG + Intronic
1144824919 17:18100414-18100436 CAAGCCTAACATCTACTTCAAGG + Exonic
1148813368 17:50309156-50309178 GAGGGCTGACATCTTCTTCAGGG + Intergenic
1150730955 17:67693171-67693193 GAGGTTTGGCATGGACTTCAAGG + Intronic
1150979617 17:70126607-70126629 CAGGTCTGCCCTCAACTTCCTGG - Intronic
1151928373 17:77214983-77215005 CAGCTCTCGCATCCACTTCAGGG + Intronic
1153537264 18:6115782-6115804 CAGGTCTGAAGACGACTTCGTGG - Intronic
1156409635 18:36815469-36815491 CATATCTGACATACACTTCAAGG + Intronic
1157324233 18:46657442-46657464 CAGGTGGGAAATGGACTTCAAGG - Intergenic
1159572161 18:70128441-70128463 CATATCTGACACCGGCTTCAAGG + Exonic
1162178162 19:8847176-8847198 CAGGTCACACATAGACTTGAAGG + Intergenic
1166069311 19:40377996-40378018 CTGGTCTGGCAACTACTTCACGG + Exonic
925122644 2:1431217-1431239 CAGGTCTCACATGGACTTCCTGG - Intronic
928698199 2:33871913-33871935 CAGGTCACACATGGACTTGAAGG - Intergenic
930421664 2:51161202-51161224 CAAGTCTGCCATCAACTTCCTGG + Intergenic
932297575 2:70639867-70639889 CAGCTCTAACAGCCACTTCAGGG - Intronic
935066997 2:99658010-99658032 CACGTGTGACATCCACTTCCTGG + Intronic
942585462 2:177470832-177470854 CAGATCTGATAAAGACTTCATGG - Intronic
946374644 2:219300761-219300783 CAGTTCTGCCATCAACTTGATGG + Intronic
946577912 2:221096222-221096244 CAGGTATGAAATCTACTTCATGG - Intergenic
1171136239 20:22696993-22697015 CATGTCTGGCTTCAACTTCATGG + Intergenic
1172176870 20:32977772-32977794 CAGCTCTGACCTGGACTTCCTGG + Intergenic
1173569426 20:44066962-44066984 CAGGGCTGACAGTGACTGCAGGG - Intronic
1175038673 20:56024527-56024549 CAGACCTGACCCCGACTTCATGG - Intergenic
1175168392 20:57062624-57062646 CAGGTCACACATGGACTTGAAGG + Intergenic
953033747 3:39193849-39193871 CAGGACTGACATTGACTACATGG - Intergenic
961343108 3:126243580-126243602 CAGGTCACACATGGACTTGAAGG + Intergenic
965059311 3:163763160-163763182 CAGGTCTTACATTTGCTTCATGG + Intergenic
967039228 3:185674204-185674226 CAGGTCTGAGATTTGCTTCAAGG + Intronic
967070876 3:185961370-185961392 CAGGTCACACATGGACTTGAAGG + Intergenic
969976531 4:11108185-11108207 CAGGTCATACATGGACTTGAAGG + Intergenic
983810179 4:172051400-172051422 CAGGTCACACATGGACTTGAAGG + Intronic
984718801 4:182951592-182951614 CAGGTCACACATGGACTTGAAGG + Intergenic
985617145 5:929921-929943 CATGTCTGACATCCAGATCATGG - Intergenic
985693021 5:1323846-1323868 CAGGTATGACAAGTACTTCATGG + Exonic
987190213 5:15469870-15469892 CAGGTCACACATGGACTTGAAGG + Intergenic
987251772 5:16107979-16108001 CAGGTCACACATGGACTTGAAGG - Intronic
992474475 5:77088447-77088469 CAGGTCACACATGGACTTGAAGG + Intergenic
994348857 5:98720872-98720894 CAGAACTGTCATTGACTTCAGGG - Intergenic
999804822 5:155071762-155071784 CAGGTCTCACATCCAGGTCATGG + Intergenic
1001574561 5:172754570-172754592 TATGTCTGACAAGGACTTCATGG - Intergenic
1002846327 6:948391-948413 CAGGTCTCACTTTGAATTCATGG - Intergenic
1007868459 6:45003481-45003503 CAGATCTGACTCCCACTTCAGGG + Intronic
1012134597 6:95540496-95540518 CTGGTCTGATATGGACTTCTCGG - Intergenic
1013472055 6:110474723-110474745 CAGCTCTGTCATCCACTGCATGG - Intronic
1013476128 6:110508867-110508889 CAGGTCACACATGGACTTGAAGG - Intergenic
1015403128 6:132809269-132809291 CAGGGCTGACTTAGAGTTCATGG - Intergenic
1024607857 7:51037529-51037551 CAGCTCTGCCCTGGACTTCATGG - Intronic
1025727274 7:64078176-64078198 CAGGTCTGAGAACCACTTAAAGG - Intronic
1026562069 7:71458602-71458624 CAGGTCACACATGGACTTGAAGG + Intronic
1028872272 7:95782723-95782745 CAGGTCACACATGGACTTGAAGG + Intronic
1030926447 7:115461281-115461303 CAGGTCAGTCATCAACCTCAGGG - Intergenic
1037650963 8:20838224-20838246 TAGGTTTGTCATTGACTTCATGG + Intergenic
1037900618 8:22686314-22686336 CAGGTCTGGCCTCAACTTCTTGG + Intergenic
1038718395 8:30011990-30012012 CAGGTCAGGCTTCGAGTTCAAGG + Intergenic
1044514751 8:93125086-93125108 AGGGTCTGACATCCACTTGAGGG + Intergenic
1048284742 8:133133038-133133060 CAGGTCTGACATCCCCTTTATGG + Intronic
1052231461 9:26159313-26159335 CAGATTTGACATCGACATGAAGG + Intergenic
1056649259 9:88443908-88443930 CAGGTCTGACAAAAACTCCAGGG - Intronic
1057737753 9:97680809-97680831 TAGGTCTGAAATCGACTTTCGGG + Intronic
1188390345 X:29611741-29611763 CAGGTCAGACATGGACTTGAAGG + Intronic
1190581460 X:51895427-51895449 CAAGTCTGAGATGGCCTTCAAGG + Exonic
1196734483 X:118972623-118972645 CAGGTCTGACCCCGACTAAATGG + Intergenic
1197739255 X:129876661-129876683 CAGGTCACACATGGACTTGAAGG - Intergenic
1198853904 X:140995790-140995812 CAGGTCTCACATGGATTTGAAGG + Intergenic
1198878110 X:141249316-141249338 CAGGTCTCACATGGATTTGAAGG - Intergenic
1200838829 Y:7759594-7759616 CGGGTCAGACATCGTCTTTAAGG - Intergenic