ID: 1062974566

View in Genome Browser
Species Human (GRCh38)
Location 10:1674069-1674091
Sequence TCAGGTCTGACATCGACTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062974566_1062974581 26 Left 1062974566 10:1674069-1674091 CCTGAAGTCGATGTCAGACCTGA 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1062974581 10:1674118-1674140 GCCCCGTCGGCCGGGGGCCCAGG No data
1062974566_1062974580 20 Left 1062974566 10:1674069-1674091 CCTGAAGTCGATGTCAGACCTGA 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1062974580 10:1674112-1674134 GGAACGGCCCCGTCGGCCGGGGG No data
1062974566_1062974574 4 Left 1062974566 10:1674069-1674091 CCTGAAGTCGATGTCAGACCTGA 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1062974574 10:1674096-1674118 TGCAAGGAGGCCACTGGGAACGG No data
1062974566_1062974575 13 Left 1062974566 10:1674069-1674091 CCTGAAGTCGATGTCAGACCTGA 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1062974575 10:1674105-1674127 GCCACTGGGAACGGCCCCGTCGG No data
1062974566_1062974573 -1 Left 1062974566 10:1674069-1674091 CCTGAAGTCGATGTCAGACCTGA 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1062974573 10:1674091-1674113 AGGGCTGCAAGGAGGCCACTGGG No data
1062974566_1062974570 -9 Left 1062974566 10:1674069-1674091 CCTGAAGTCGATGTCAGACCTGA 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1062974570 10:1674083-1674105 CAGACCTGAGGGCTGCAAGGAGG No data
1062974566_1062974579 19 Left 1062974566 10:1674069-1674091 CCTGAAGTCGATGTCAGACCTGA 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1062974579 10:1674111-1674133 GGGAACGGCCCCGTCGGCCGGGG No data
1062974566_1062974577 17 Left 1062974566 10:1674069-1674091 CCTGAAGTCGATGTCAGACCTGA 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1062974577 10:1674109-1674131 CTGGGAACGGCCCCGTCGGCCGG No data
1062974566_1062974572 -2 Left 1062974566 10:1674069-1674091 CCTGAAGTCGATGTCAGACCTGA 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1062974572 10:1674090-1674112 GAGGGCTGCAAGGAGGCCACTGG No data
1062974566_1062974578 18 Left 1062974566 10:1674069-1674091 CCTGAAGTCGATGTCAGACCTGA 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1062974578 10:1674110-1674132 TGGGAACGGCCCCGTCGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062974566 Original CRISPR TCAGGTCTGACATCGACTTC AGG (reversed) Intronic
901012943 1:6211325-6211347 CCCGGTCTGCCATGGACTTCAGG - Intronic
910870667 1:91830139-91830161 TCAGGTCTGGCCTCTAGTTCTGG - Intronic
914964506 1:152242548-152242570 TCAGGACAGACATCGATTTATGG - Intergenic
915824673 1:159062877-159062899 TCAGGTCAGATATTCACTTCAGG - Intronic
920850683 1:209626094-209626116 TCAGGTCAGACCTCCTCTTCAGG - Intronic
920853913 1:209648331-209648353 TCAGGTCTGCCACTGACTTGAGG - Intronic
922937162 1:229431835-229431857 TGAAGTGTGACATCGACATCAGG - Exonic
1062974566 10:1674069-1674091 TCAGGTCTGACATCGACTTCAGG - Intronic
1063789939 10:9433010-9433032 AGATGTCTGACATTGACTTCTGG + Intergenic
1068858730 10:61824610-61824632 TCAGCTCTGACATCAAATACCGG + Intergenic
1072464277 10:95648791-95648813 TCAGGTCTCAGATTGACTTAGGG - Intronic
1072554268 10:96502760-96502782 ACAGGACTCACATCGACTCCAGG + Intronic
1075818239 10:125283015-125283037 TCAGGTCTGCCCTTGACTGCAGG - Intergenic
1077129614 11:964347-964369 TCAGCTCTGACCTGGAGTTCTGG + Intronic
1077622110 11:3735205-3735227 TAGGGTCTGACATCGGATTCCGG + Exonic
1081649488 11:44814185-44814207 TCAGGACTGACATCTGCATCTGG + Intronic
1086278447 11:85159149-85159171 TCTGAACTGACATCGATTTCAGG + Intronic
1086382688 11:86274297-86274319 TCAGATCTGACATAGATTTAAGG - Intronic
1086855945 11:91865922-91865944 TCACTTCTGACATCGGCTTTGGG - Intergenic
1095463308 12:42464452-42464474 TCAGGTCTGACAGACACTCCAGG + Exonic
1096967242 12:55638149-55638171 TCATGACTGACATGGACCTCTGG - Intergenic
1096967596 12:55640739-55640761 TCATGACTGACATGGACCTCTGG - Intergenic
1102349356 12:112180752-112180774 GCAGACCTGACATCGACTTTGGG + Intronic
1103978563 12:124720568-124720590 TCATGTTTAACATCGACCTCAGG - Intergenic
1108100553 13:46949463-46949485 TCAGTTCTGATATCAACTCCTGG - Intergenic
1108326252 13:49334533-49334555 CCAGCTCAGACATCGTCTTCGGG + Intronic
1115855683 14:37627189-37627211 ACAGATCTGGCATCGCCTTCTGG - Intronic
1124489449 15:30144796-30144818 TCAGGTCTGCCTTCTCCTTCAGG - Exonic
1124520578 15:30404493-30404515 TCAGGTCTGCCTTCTCCTTCAGG + Exonic
1124538078 15:30561726-30561748 TCAGGTCTGCCTTCTCCTTCAGG - Exonic
1124754078 15:32393531-32393553 TCAGGTCTGCCTTCTCCTTCAGG + Exonic
1124760573 15:32445859-32445881 TCAGGTCTGCCTTCTCCTTCAGG + Exonic
1124778061 15:32603203-32603225 TCAGGTCTGCCTTCTCCTTCAGG - Exonic
1143994539 17:10995303-10995325 TCAGAACTGACATTTACTTCTGG + Intergenic
1152504977 17:80743369-80743391 TCAGGTTAGACATCTCCTTCAGG - Intronic
1164218416 19:23171943-23171965 TCAGGTCTCAGATAGACTGCAGG - Intergenic
1168571915 19:57477477-57477499 TCAGGTCTGACATTGCGTTCTGG + Exonic
927176150 2:20410360-20410382 TCAGGTCTGACATAGTCTACAGG + Intergenic
932297576 2:70639868-70639890 TCAGCTCTAACAGCCACTTCAGG - Intronic
935856116 2:107276177-107276199 TCAGCTGTGACCTCGTCTTCTGG + Intergenic
940384597 2:153055960-153055982 CCAGGTCTCAAATCAACTTCTGG + Intergenic
942222845 2:173788226-173788248 TCAGTTCTCAAATCGACTACTGG + Intergenic
942528355 2:176880752-176880774 TCAGGGCTGACATCTGCTGCCGG - Intergenic
944983470 2:205148943-205148965 TCAGGTCTGAGCTGGGCTTCTGG + Intronic
945476077 2:210284599-210284621 TCAGGTCTGACACAGCCTACAGG + Intergenic
948407896 2:237736587-237736609 TCACGTCTGAGATGGGCTTCGGG + Intronic
1173622900 20:44450163-44450185 TCCGGTCTCTCATCGCCTTCCGG - Intergenic
1174951105 20:55042058-55042080 TCAGGTCTCACATCCAGGTCAGG - Intergenic
1179124978 21:38582348-38582370 TCAGTTCTGACACTGACTACCGG - Intronic
1182634673 22:31716016-31716038 TCAGGTCTGTAATCAAATTCTGG + Exonic
1182678772 22:32061845-32061867 TCAGGTCTGAGGTCCACTTTGGG + Intronic
984292479 4:177812918-177812940 TCAGGTCTGACTTCAGCTGCAGG - Intronic
985577445 5:680053-680075 CCAGGTCTGAAATCGCCTGCTGG - Intronic
985592377 5:772149-772171 CCAGGTCTGAAATCGCCTGCTGG - Intergenic
987436356 5:17898691-17898713 TCAGGTCACACATAGACTTTTGG + Intergenic
988981327 5:36572066-36572088 CCAGCTCTGACACCCACTTCTGG + Intergenic
1002396783 5:178963282-178963304 TAAGGACTGACTTCCACTTCTGG - Intronic
1007974805 6:46090235-46090257 TCAGGTGTGAAATCACCTTCAGG + Intergenic
1017846063 6:158259654-158259676 TCATGTCTGACATTCAGTTCAGG - Intronic
1028530382 7:91831938-91831960 TCAGGTCGCACACCGACTTAAGG + Intronic
1042042747 8:64610835-64610857 TTAGATCTGGCATCAACTTCTGG + Intronic
1045311725 8:101009059-101009081 TCAATTCTGACATCGTCTACTGG + Intergenic
1049755696 8:144310427-144310449 TCAGGTCTCACGTCCACTTTGGG + Intronic
1055980386 9:81994803-81994825 TCTGCTCTGACATGCACTTCTGG - Exonic
1057737752 9:97680808-97680830 GTAGGTCTGAAATCGACTTTCGG + Intronic
1058062813 9:100515888-100515910 TCAGTTCTGAAATCAACTTAAGG - Intronic
1185496591 X:558707-558729 TCAGGACTGACTTCTAGTTCTGG - Intergenic
1190250387 X:48719321-48719343 TCAGGTCTGTGATCTATTTCTGG - Intergenic
1201421237 Y:13801778-13801800 TCATGTTTGACAATGACTTCAGG + Intergenic