ID: 1062974572

View in Genome Browser
Species Human (GRCh38)
Location 10:1674090-1674112
Sequence GAGGGCTGCAAGGAGGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062974565_1062974572 -1 Left 1062974565 10:1674068-1674090 CCCTGAAGTCGATGTCAGACCTG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1062974572 10:1674090-1674112 GAGGGCTGCAAGGAGGCCACTGG No data
1062974566_1062974572 -2 Left 1062974566 10:1674069-1674091 CCTGAAGTCGATGTCAGACCTGA 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1062974572 10:1674090-1674112 GAGGGCTGCAAGGAGGCCACTGG No data
1062974564_1062974572 0 Left 1062974564 10:1674067-1674089 CCCCTGAAGTCGATGTCAGACCT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1062974572 10:1674090-1674112 GAGGGCTGCAAGGAGGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062974572 Original CRISPR GAGGGCTGCAAGGAGGCCAC TGG Intronic
No off target data available for this crispr