ID: 1062975569

View in Genome Browser
Species Human (GRCh38)
Location 10:1680042-1680064
Sequence AACAGGCTGGGGAGGCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 515
Summary {0: 1, 1: 0, 2: 7, 3: 49, 4: 458}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062975569 Original CRISPR AACAGGCTGGGGAGGCCTGG GGG (reversed) Intronic
900088026 1:907930-907952 AACAGCCTGGGAAGTCCCGGGGG - Intergenic
900091877 1:924250-924272 GGCAGTCCGGGGAGGCCTGGCGG + Intergenic
900100485 1:960210-960232 AACAGGAGGGCGAGGCCTGTGGG + Intergenic
900305380 1:2004063-2004085 GACAGACTTGGGGGGCCTGGAGG + Intergenic
900458206 1:2787464-2787486 AACCAGGTGAGGAGGCCTGGGGG - Exonic
900648278 1:3718701-3718723 AACTGGCTGAGGAGCCCAGGCGG + Intronic
900796151 1:4709453-4709475 CAGAGTCTGGTGAGGCCTGGTGG + Intronic
900833101 1:4979102-4979124 AACAGCCTGGGGAGGCAGGATGG + Intergenic
901055925 1:6448568-6448590 AGCTGGGTGGGGAGGCGTGGGGG + Intronic
901384117 1:8895839-8895861 AACAGTCTGGCCAGGCATGGTGG + Intergenic
902478469 1:16700071-16700093 AGCTGGGTGGGGAGGCGTGGGGG - Intergenic
902511042 1:16967344-16967366 GACAGGCTGGGGAGGGCAGAGGG - Intronic
902984556 1:20147820-20147842 AACAAGCCTGGGAGGCGTGGGGG + Intronic
903383070 1:22910017-22910039 GGCAGACTGGGGAGGCCTTGGGG + Intronic
903450804 1:23452552-23452574 ATGAGCCTGGGGAGGTCTGGAGG - Intronic
903739278 1:25549308-25549330 ACCAGGCTGGGGGAGGCTGGAGG + Intronic
904079213 1:27861515-27861537 AAAAGGCTGGGGAAGCGAGGAGG + Intergenic
904492489 1:30869729-30869751 AAGGGGCAGGGAAGGCCTGGGGG + Intronic
904511950 1:31018372-31018394 TAAAGGCTGGCGAGGCGTGGTGG + Intronic
904611348 1:31727881-31727903 AACAGTCTGGGGCCGCCTGGGGG - Intronic
905178097 1:36150577-36150599 GCCAGGCTAGGGAGGGCTGGGGG + Intronic
905180222 1:36160966-36160988 AACAGCCTGGGCAGCCCTGCTGG + Intronic
905394094 1:37656180-37656202 CAGCAGCTGGGGAGGCCTGGAGG + Intergenic
905452895 1:38068437-38068459 AACCTGCAGGGGAGGGCTGGTGG + Intergenic
907448637 1:54527494-54527516 AACAGACTGGCCGGGCCTGGTGG + Intergenic
907569405 1:55468904-55468926 AACTGTCTGGGGTGGCCTGCTGG + Intergenic
908993476 1:70124235-70124257 AACAGGCAGGCCAGGCGTGGTGG + Intronic
912075514 1:105870469-105870491 TACATGCTGGGGACTCCTGGAGG - Intergenic
912246781 1:107968268-107968290 ACCAGCCAGGGCAGGCCTGGAGG - Intergenic
912913822 1:113791059-113791081 AACAGAATTGGGAGGACTGGAGG + Intronic
915565710 1:156711485-156711507 GGCAGGCTGGGGGGCCCTGGAGG - Intergenic
915686476 1:157639480-157639502 CACAGGCAGGGGTGGGCTGGGGG - Intergenic
916844606 1:168636909-168636931 AACAGGGTGGAGAAGCCAGGGGG + Intergenic
916881776 1:169025897-169025919 ACCAGGCTGGCCAGGCATGGTGG - Intergenic
917638076 1:176956330-176956352 AAAAGTCTGGGGAGGCCTTAGGG + Intronic
919663364 1:200269425-200269447 ACAAGGCTGTGAAGGCCTGGAGG - Intergenic
919917996 1:202150927-202150949 AAGAGGAAGGGGAGGCCTAGGGG - Intronic
920260589 1:204685439-204685461 CACAGGCCGGGGAGGCTCGGCGG + Intronic
920298176 1:204972512-204972534 CAGAGGCTGGAGAGGGCTGGGGG - Intronic
920518374 1:206603305-206603327 AACAGGCAGGAGTGGCCAGGAGG + Intronic
920674627 1:208030508-208030530 AACAGGCTGGGGTGGCCCTGGGG - Intronic
921324952 1:213980435-213980457 AACGGGATGGGGAGGGCTGGGGG - Intergenic
922452860 1:225750817-225750839 GACAGACTGGGGAGGACTTGGGG - Intergenic
922571396 1:226636464-226636486 ATCTGCCTGAGGAGGCCTGGTGG + Intronic
923684343 1:236143248-236143270 AGAAGGCAGGGGAGGGCTGGAGG + Intronic
1062882974 10:993532-993554 AACAGGCAGGCCAGGCGTGGTGG - Intronic
1062975569 10:1680042-1680064 AACAGGCTGGGGAGGCCTGGGGG - Intronic
1064283082 10:13969083-13969105 ACCAGGCTGGGGTGGTCTGCAGG - Intronic
1065133202 10:22643465-22643487 AACAGGGATGGAAGGCCTGGTGG - Intronic
1065876920 10:30005191-30005213 AACAGGCTGGGGAGGATAGAAGG - Intergenic
1065920982 10:30392612-30392634 ATCAGGGTGGGGAGGCAGGGTGG + Intergenic
1066242616 10:33552784-33552806 AACAGGCTGGTCAGGCTTGCTGG + Intergenic
1067709376 10:48636140-48636162 AACATCCTGGAGAGGCTTGGGGG + Intronic
1067848599 10:49741032-49741054 GGCAGGCTGGGGAGGCCTGGTGG - Intronic
1068022777 10:51605235-51605257 CACAGGATGGGGGGGCATGGTGG + Intronic
1069236430 10:66081322-66081344 AACAGGATGTCCAGGCCTGGTGG + Intronic
1069601530 10:69711114-69711136 AAAAGGCTGGGGTGGTGTGGGGG + Intergenic
1069916489 10:71790146-71790168 GACAGGGTGGGGAGGCCCTGGGG - Intronic
1072425123 10:95323698-95323720 AGCAGGCTGGCCAGGCATGGTGG + Intronic
1072553311 10:96495226-96495248 AACAGGCTGAGGTGGGGTGGAGG + Intronic
1072562270 10:96587026-96587048 AAGAGGCTGAGGAGGCGCGGGGG - Exonic
1072918479 10:99555504-99555526 AACAGGCTGAGCAGGACTGGAGG - Intergenic
1073441542 10:103555458-103555480 GACCGCCTGGGGAGGCCGGGCGG + Intronic
1073477711 10:103765255-103765277 CACAGGATGGGTAGGCTTGGAGG - Intronic
1073538569 10:104299762-104299784 TACAGGCTAGGCAGGCCAGGTGG - Intronic
1074457886 10:113611467-113611489 AACAGGATGTGGATGCCTGTTGG + Intronic
1074955132 10:118381177-118381199 CTCAGGCTGGGGAAGCATGGGGG - Intergenic
1075522119 10:123149298-123149320 AACAGGGAGAGGAGGTCTGGAGG - Intronic
1076189304 10:128471380-128471402 AACAGGCTGAGGCGGCCCAGTGG - Intergenic
1076363004 10:129902887-129902909 ACCAGGCTGGGTAGGCCCAGGGG - Intronic
1076418750 10:130312792-130312814 AAGAGGCTGGGAAGGCCTTTTGG + Intergenic
1076672882 10:132132845-132132867 AACAGGCAGGGGAGACCATGGGG - Intronic
1077217762 11:1402154-1402176 AGCAGCCTGGGGAAGGCTGGGGG + Intronic
1077233306 11:1468317-1468339 AACAGGGGCGGGTGGCCTGGTGG - Intergenic
1077889270 11:6406898-6406920 ACCAGGCTGTGAAGGCCAGGAGG + Intronic
1078928141 11:15892528-15892550 AACAGGCTGGGGGTGGCAGGAGG - Intergenic
1079089959 11:17473935-17473957 CACAGGCTGGGGAGCGATGGAGG - Intronic
1080408324 11:31999896-31999918 AAAAGGCTGGGCTGGCCTGTTGG + Intronic
1081527352 11:43936041-43936063 CAAAGGGTGGGCAGGCCTGGGGG - Intronic
1081606167 11:44528323-44528345 CTCAGGCTGGTGAGGCCTGGTGG - Intergenic
1083615425 11:64023756-64023778 AACAGGCAGGGGGCACCTGGAGG - Intronic
1083757030 11:64797246-64797268 CTCAGGCTTGGGAGGCCAGGAGG - Intronic
1084181431 11:67448485-67448507 GCCATGGTGGGGAGGCCTGGGGG + Intergenic
1084537948 11:69768863-69768885 AGCAGGATGGGGAGGTGTGGGGG - Intergenic
1084659165 11:70537036-70537058 ATGAGGCTGGGGAGGGGTGGGGG + Intronic
1085304393 11:75476905-75476927 AAGAGGCTGGAGTGGCCAGGGGG - Intronic
1085310050 11:75510769-75510791 AAGAGCATGGGGAGGCCCGGAGG - Intronic
1085403703 11:76249402-76249424 AACAGGCTGGAGAGGTTTGAGGG + Intergenic
1085510729 11:77086796-77086818 AAGAGGCTGGTGAGGCCTGGCGG + Intronic
1085517113 11:77118102-77118124 AAGAGCCTGGGGAGGTGTGGGGG + Intronic
1088626612 11:111734458-111734480 AAAAGACTTGGAAGGCCTGGGGG + Intronic
1089571122 11:119410643-119410665 AAAAGGCTGGGGAAGCATTGAGG - Intergenic
1090388129 11:126368442-126368464 CACAGTCTGGGGAGGCCTTGGGG + Intronic
1090390870 11:126386421-126386443 CACAGTCTGGGGAGGCCTTGGGG + Intronic
1090398919 11:126436030-126436052 AACAGGATGGGGAGCCTTGGAGG - Intronic
1090747676 11:129720341-129720363 GACAGGCAGGGGATGCCTGCAGG - Intergenic
1091108517 11:132944070-132944092 ACCGGGCTGGGGATGCCTGCGGG + Intronic
1091828544 12:3533278-3533300 AGCAAGCTGGGGAGCCCGGGAGG + Intronic
1092178980 12:6431906-6431928 AACAGGCTGGCCGGGCGTGGTGG + Intergenic
1093908074 12:24715267-24715289 AAGAGTCTGTGGAGGCATGGGGG + Intergenic
1094813461 12:34163295-34163317 AACAGGCTGGGGGAGTATGGTGG + Intergenic
1096516008 12:52155588-52155610 GACAGGCTGGGGAGGAAGGGTGG + Intergenic
1097234033 12:57527874-57527896 AACAGGCTGGGGAGGGCTCCAGG - Exonic
1097247833 12:57616328-57616350 AACAGCCTGGGGCGGCCAAGAGG + Exonic
1097264896 12:57738978-57739000 GATAGGGTGGGGGGGCCTGGGGG - Intronic
1098790020 12:74810496-74810518 AATAGGCCGGGCAGGCATGGTGG + Intergenic
1099089136 12:78282582-78282604 ACAAGGCTGGGCAGGCATGGTGG + Intergenic
1100526168 12:95421620-95421642 AACAAGCTGGCCAGGCATGGTGG - Intergenic
1101379883 12:104205302-104205324 CACAGGATTGGGAGGCGTGGTGG + Intergenic
1102006307 12:109591201-109591223 GAACGGCTGGTGAGGCCTGGGGG - Intronic
1102208986 12:111110821-111110843 AGAAGGCTGGGGAGGCGTGAAGG + Intronic
1102290487 12:111695247-111695269 AACAGGCAGAGGAGGCAGGGAGG - Intronic
1102933009 12:116876759-116876781 CTGAGGCTGGGGAGGCCTGGAGG - Intronic
1103055168 12:117814099-117814121 AACAGGCTGGGAAGGCTAAGGGG + Intronic
1103432511 12:120901143-120901165 AACAGGCTTGGGAGGCCAAGTGG - Intronic
1103462616 12:121117191-121117213 CAGAGGCTGGTGGGGCCTGGGGG - Intergenic
1103777844 12:123379783-123379805 AAAAGGCAGGCCAGGCCTGGTGG - Intergenic
1104175858 12:126332115-126332137 ATCAGGCTGGGGCTGCCTGAAGG - Intergenic
1104190599 12:126479133-126479155 AAGAAGCTGGGGAGGCCTGAAGG - Intergenic
1104279655 12:127363485-127363507 AGCAGCCTGCAGAGGCCTGGTGG - Intergenic
1104477535 12:129083010-129083032 AACATGCTGGCCAGGCATGGTGG - Intronic
1104747069 12:131217209-131217231 AACAGGGTCAGGAGGCCTGGGGG + Intergenic
1105547814 13:21364607-21364629 GACCCGATGGGGAGGCCTGGTGG + Intergenic
1106072639 13:26427002-26427024 AAGAGGGTGGGGATTCCTGGAGG + Intergenic
1109967859 13:69724957-69724979 ATCACGCTGGTGAGGCTTGGGGG - Intronic
1112508161 13:99987885-99987907 ACCAGGCTGGCCAGGCCTGAGGG + Intergenic
1113547884 13:111168332-111168354 AGGTGGCTGGGCAGGCCTGGAGG - Intronic
1113808572 13:113123820-113123842 CAGAGGCTGGGGAGGGCAGGGGG - Intronic
1113811672 13:113146430-113146452 ACCAGGGTGGGGCGCCCTGGAGG + Intronic
1113940370 13:114015759-114015781 GACAGCCTGGGGAGGCAGGGAGG + Intronic
1114646150 14:24257289-24257311 AGCTGGCAGGGCAGGCCTGGTGG + Intronic
1115840010 14:37459785-37459807 AACAGGCTGGGTGGGCGTGGTGG + Intronic
1117647174 14:57865284-57865306 CGCAGGCTGGGGAGGCTCGGGGG - Intronic
1118852117 14:69592016-69592038 TACAGGTTGGGGTGGGCTGGGGG + Intergenic
1119270876 14:73303290-73303312 AACATGCTGGCCAGGCATGGTGG + Intronic
1119666493 14:76488783-76488805 AAGAGTCTGGGGAGGCTTTGTGG - Intronic
1119783862 14:77297926-77297948 AACAGGCCGTGGAGACCTAGTGG - Intronic
1120158584 14:81121182-81121204 AAAAGGGTGGGGAGGCATGAAGG + Intronic
1120946497 14:90002718-90002740 AAAAGGCGGGGGATGCTTGGTGG + Intronic
1120972855 14:90222979-90223001 CAATGGCTGGGGAGGCCTGAGGG + Intergenic
1121210988 14:92207772-92207794 AACAGCCTGGGGAGCTCCGGAGG - Intergenic
1121786268 14:96663432-96663454 AACTGGGCGGGGAGGCCTAGGGG - Intergenic
1122156015 14:99750863-99750885 GGAAGGCTGGGGTGGCCTGGGGG + Intronic
1122778677 14:104134512-104134534 AGCAGGCTGGGGAGAGATGGCGG + Intergenic
1122791990 14:104187882-104187904 ACCTGGCGGGGGCGGCCTGGGGG + Intergenic
1122920155 14:104876650-104876672 AGCCTTCTGGGGAGGCCTGGGGG - Intronic
1122996493 14:105268081-105268103 GACAGGCTGGTGAGCCCTAGAGG - Intronic
1123072413 14:105648199-105648221 AAGAGGCTGGGGAGACGTGGGGG - Intergenic
1123117437 14:105901002-105901024 GACAGGGTGGGGTGCCCTGGAGG + Intergenic
1124060895 15:26292880-26292902 CACATGCTGGAGAGGGCTGGTGG - Intergenic
1124344405 15:28912547-28912569 TTCAGGCTGGGGAGTCCTGATGG + Intronic
1125869251 15:43083753-43083775 AAAAGGCTGGCCAGGCTTGGTGG + Intronic
1127098261 15:55535284-55535306 AACAGCCTTGGGTGTCCTGGGGG + Intergenic
1127940280 15:63688316-63688338 AGGAGGCTGGGAAAGCCTGGGGG + Intronic
1129154410 15:73709036-73709058 CAGAGGCTGGGGATGGCTGGAGG + Intronic
1129257023 15:74339410-74339432 AGCAGCCTGGGGGGACCTGGGGG + Intronic
1129318796 15:74762487-74762509 CAGAAGCTGGGGAGGGCTGGGGG + Intergenic
1129740590 15:77987808-77987830 TCCTGGCTGTGGAGGCCTGGTGG + Intronic
1129845156 15:78764749-78764771 TCCTGGCTGTGGAGGCCTGGCGG - Intronic
1132539750 16:503215-503237 GACAGTCTGGGGAGCCCTGGAGG - Intronic
1133282681 16:4676156-4676178 AAGAGGCTGCTGGGGCCTGGAGG + Intronic
1133774491 16:8886362-8886384 AGCAGCCTGGGGAGGTCGGGTGG - Intergenic
1134059802 16:11192316-11192338 AGAAGGATGGGGAGCCCTGGAGG + Intergenic
1134140762 16:11716458-11716480 AACAGGCTTTGCAGTCCTGGAGG + Intronic
1136508446 16:30721296-30721318 AACAGGCTAGAGGAGCCTGGAGG - Exonic
1136614953 16:31393082-31393104 AACTGGCTCCTGAGGCCTGGGGG + Intergenic
1137721520 16:50630325-50630347 ATCAGGCTGGTGAGGGCTGCAGG + Exonic
1137766969 16:50985233-50985255 AAGGGTCTGGGGAGCCCTGGAGG + Intergenic
1137768495 16:50996116-50996138 AACAGGATGGGGACACCTGATGG - Intergenic
1139226273 16:65235611-65235633 AACAGGGTGGGGAGCACTGGTGG + Intergenic
1139357083 16:66372851-66372873 CTCAGTCTGGGGAGGTCTGGAGG - Intronic
1139383165 16:66547435-66547457 AGGTGGCTGGGGAGGGCTGGGGG - Intronic
1140791991 16:78400668-78400690 AACAGGGAAGGGAGGACTGGAGG + Intronic
1140990729 16:80208961-80208983 AGCTGGCTGGGGAGGGCTCGGGG - Intergenic
1141572278 16:84941261-84941283 AAGAGACTGGAGAGGGCTGGAGG + Intergenic
1141707634 16:85676700-85676722 AATAGGCTGGCCAGGCATGGCGG + Exonic
1142258932 16:89033419-89033441 TACAGGCAGGGAAGACCTGGAGG + Intergenic
1142807720 17:2380177-2380199 ACAAGGCCGGGGAGGCCTGGGGG - Exonic
1143309831 17:5979015-5979037 ACCAGGCTGGGGTGGACAGGTGG + Intronic
1144199699 17:12929077-12929099 GACAGGCTGGGGAGCCCTCAGGG + Intronic
1144583477 17:16473650-16473672 GACAGGCTGGGCAAGTCTGGTGG - Intronic
1144813671 17:18018470-18018492 CACAGGCTGGGGAGCCCTGAAGG + Exonic
1145241853 17:21244799-21244821 TCCAGGCTTGGCAGGCCTGGTGG - Intronic
1145969903 17:28950619-28950641 AAGGGGGTGGGGAGGCCTGCCGG + Intronic
1146182178 17:30705586-30705608 CACGGGCTGGGGGCGCCTGGTGG + Intergenic
1147248596 17:39139105-39139127 CACAGGGAGGAGAGGCCTGGAGG - Intronic
1147326055 17:39670144-39670166 ACCACGCTGCTGAGGCCTGGGGG + Exonic
1147611274 17:41803149-41803171 AACAGGCTGGAGGCCCCTGGAGG + Intronic
1148115446 17:45172357-45172379 GACAGGCTGGGCAGGGGTGGTGG - Intergenic
1148130031 17:45256988-45257010 AAAAGGCTGGGGAGGGCGTGGGG - Intronic
1148809516 17:50281017-50281039 AATGGGCTTGGGAGACCTGGAGG + Exonic
1148997295 17:51722294-51722316 AAGTGGCTGGGGAGGCATGAGGG - Intronic
1149962895 17:61131629-61131651 TACAGGCTGCAAAGGCCTGGAGG - Intronic
1151208508 17:72526312-72526334 AAAATGCTGGGCAGGCATGGTGG - Intergenic
1151418980 17:73985206-73985228 AGCAGGCAGGGGAGGCTTGACGG - Intergenic
1151550898 17:74821939-74821961 AACAGGCTGGGGAGAGGTGGAGG + Intronic
1151908184 17:77063188-77063210 AACAGGCAGGGTTGGCCTTGGGG - Intergenic
1152287308 17:79420605-79420627 AGCAGGCAGGGCAGGCCTAGGGG + Intronic
1152340378 17:79720987-79721009 AACCAGCGAGGGAGGCCTGGGGG + Intergenic
1152577515 17:81149376-81149398 CACAGGCCGGGGAGGGCAGGAGG - Intronic
1152729597 17:81962921-81962943 ATCAGGCTGGGGTGCCCTGGAGG + Intergenic
1152811628 17:82385349-82385371 CCCAGGCTGGGAGGGCCTGGGGG + Intergenic
1153648171 18:7214056-7214078 AAGAGCCTGGGGAAGCCTGGAGG - Intergenic
1153867934 18:9290326-9290348 AACAGGCTGGGCATGCCTATAGG - Intergenic
1155393667 18:25363923-25363945 ACCAGCATGGGGAGGCATGGTGG - Intergenic
1156183140 18:34629675-34629697 AACAGGCATAGGTGGCCTGGAGG - Intronic
1156293924 18:35773296-35773318 AAGGGGCTGGGGACACCTGGAGG - Intergenic
1156533166 18:37837568-37837590 AACAGCCAGGTGAGGCCTGGAGG + Intergenic
1157202244 18:45669013-45669035 ATCAGGTTGGGGAGGCCGAGGGG - Intronic
1159708946 18:71729738-71729760 AACTGGCCGGGGAGGCCGAGGGG + Intergenic
1160149418 18:76387903-76387925 TACAGGATAGGGAGGCATGGCGG - Intronic
1160703420 19:518518-518540 CCCAGGCTGGGGATGCTTGGGGG + Intronic
1160822342 19:1064413-1064435 GACAGGCTGGGGTGTGCTGGGGG + Intronic
1160834011 19:1116243-1116265 AGTGGGCTGGGGAGGACTGGGGG + Intronic
1161199139 19:3004935-3004957 AACAGGCTGGACAGAGCTGGGGG - Intronic
1161769949 19:6225658-6225680 ACCAGGCTTAGGAGGCCTGTGGG - Intronic
1162392053 19:10395738-10395760 GACAGGCTTGGGGGGCCGGGCGG - Intronic
1163018122 19:14469324-14469346 ATCAGGCTGGGGAGGGGTGGGGG - Exonic
1164845025 19:31424630-31424652 AAATGGGTGGGGAGCCCTGGTGG - Intergenic
1164960435 19:32424018-32424040 AAAAGGTTGGGGAGGCCAGCTGG + Intronic
1165005035 19:32797811-32797833 CACAGGATGAAGAGGCCTGGAGG - Intronic
1165102283 19:33446012-33446034 AACAGGCTGCGGGGTCCAGGTGG - Intronic
1165156117 19:33789149-33789171 AACTGGCTGGGGAGGAAGGGAGG + Intergenic
1165314641 19:35047189-35047211 GGCCAGCTGGGGAGGCCTGGTGG - Intronic
1165324508 19:35106441-35106463 ACCCGGCTGGGGAGGCCTTCTGG + Intergenic
1165324853 19:35108643-35108665 AACAGGATGGGGAGGGGCGGTGG + Intergenic
1165325942 19:35114902-35114924 AACAGGAAGGGGAGGCCCGGAGG - Intergenic
1165467355 19:35982847-35982869 GCCAGGCTGGGGAGGAATGGGGG - Intergenic
1165809741 19:38605350-38605372 ACGGGGCTGGGGATGCCTGGTGG - Intronic
1166035558 19:40165686-40165708 TACTGGGTGGGGAGGCCTCGGGG - Intergenic
1166070990 19:40387764-40387786 AACAGGCTGGCCAGGTGTGGTGG - Intronic
1166199804 19:41229578-41229600 AACAGGGTGGCCAGGCCTAGCGG + Intronic
1166931369 19:46303565-46303587 CCCAGGCTAGGGACGCCTGGGGG - Intronic
1166932309 19:46308646-46308668 ACAGGGCTGGGGAGGCCCGGGGG - Exonic
1166943476 19:46383263-46383285 AAAGGGCAGGGCAGGCCTGGGGG - Intronic
1167106942 19:47435940-47435962 AACACACTGGGGAGCCATGGAGG - Intronic
1167218577 19:48182448-48182470 GCCGGGCTGGGGAGGCCTGTGGG - Exonic
1167260741 19:48456261-48456283 CCCAGGCTGGGGAGGGCTGCAGG + Exonic
1167322552 19:48805848-48805870 GACAGCCAGGGGAGGCATGGTGG - Intronic
1167372263 19:49090248-49090270 GACAGGGTGGGAAGGACTGGGGG - Intronic
1167608911 19:50496798-50496820 AGCCAGCTGGGGAGGCCTGTGGG - Intergenic
1167644292 19:50697329-50697351 GGCAGGGTGGGGATGCCTGGGGG - Intronic
1168307418 19:55442981-55443003 GAGAGGCTGGGGAGGGCGGGCGG + Intergenic
1202663845 1_KI270708v1_random:98368-98390 TACAGGGTTGGGAGGCCTGGAGG + Intergenic
1202712488 1_KI270714v1_random:25902-25924 AGCTGGGTGGGGAGGCGTGGGGG - Intergenic
925060294 2:885533-885555 ACGAGGGTGGGGAGGACTGGGGG + Intergenic
925217990 2:2113533-2113555 ACCAGGCTGGGGAAGCCTGCGGG - Intronic
925837468 2:7960026-7960048 AGCAGCCGGGGGAGGCCTTGGGG + Intergenic
926222375 2:10944684-10944706 AGCAGGCAGTGGAGTCCTGGAGG - Intergenic
926320750 2:11746867-11746889 AACAGGCCCCGGAGGCCGGGAGG + Intronic
927207781 2:20620963-20620985 AGCAGGCTGGGAAGGCCTCCTGG + Intronic
927245622 2:20955371-20955393 AACAGGCCCGGGAGGGCTGTTGG - Intergenic
927513671 2:23659780-23659802 CAGAGGCTGGCCAGGCCTGGAGG - Intronic
927845913 2:26472910-26472932 GACAGCCTGGGGGGGCCTGAGGG - Intronic
928749233 2:34452828-34452850 ACATGGCTGGGGAGGCCTGAAGG + Intergenic
930028690 2:47045276-47045298 CAGATGCTGGGGAGGTCTGGGGG - Intronic
932218496 2:69982698-69982720 TGCAGGCTGGGCAGTCCTGGGGG + Intergenic
933920344 2:87039491-87039513 AACAGGCTGTTGGGGACTGGGGG - Intergenic
933931280 2:87154295-87154317 AACAGGCTGTTGGGGACTGGGGG + Intergenic
934002653 2:87730408-87730430 AACAGGCTGTTGGGGACTGGGGG + Intergenic
934537105 2:95143796-95143818 AACATTCTTGGAAGGCCTGGAGG + Intronic
934538917 2:95159078-95159100 CGCAGGCTGGGGCTGCCTGGGGG + Intronic
934539828 2:95164701-95164723 AACAGACTGGGAAGGGTTGGCGG + Intronic
934558674 2:95300960-95300982 TAAAGGCTGGGGAAGGCTGGGGG - Intronic
934766011 2:96880395-96880417 AACAGGCTGGGGGTGCCTGGGGG + Intronic
936361841 2:111811136-111811158 AACAGGCTGGTGGGGACTGGGGG - Intronic
936489969 2:112961536-112961558 AGCAGGCTGTGGAGTCCTGCTGG + Intergenic
937216911 2:120318722-120318744 GACAGGCTTGACAGGCCTGGGGG + Intergenic
937246811 2:120499063-120499085 AACAGGCTGGGGAGGGCAGTGGG - Intergenic
937259558 2:120576798-120576820 AAGACCCTGGGGAGCCCTGGCGG + Intergenic
937320287 2:120956780-120956802 AGCAGGTTGGGGTGGGCTGGTGG + Intronic
937324016 2:120978321-120978343 CACAGGTCGGGGAGGGCTGGGGG + Intronic
937862342 2:126720861-126720883 CACAGCCTGGGGAAGTCTGGAGG + Intergenic
937871300 2:126788161-126788183 AACAGCCTGGTGAGGGCTGGTGG + Intergenic
937910206 2:127072005-127072027 AGCAGGCAGGGGAGGCCAGGAGG - Intronic
939038555 2:137161714-137161736 CACAAGCTGCGGAGGCGTGGGGG - Intronic
940460062 2:153953683-153953705 TACAGGCTAGGGAGACCTGGAGG - Intronic
941122702 2:161549523-161549545 AAGAGGCTGTTCAGGCCTGGGGG - Intronic
942161614 2:173194869-173194891 ATCAACCTGGGGAGGGCTGGTGG - Intronic
942237103 2:173921560-173921582 AACAGGCCAGGCAGGCATGGTGG + Intronic
943266686 2:185740378-185740400 CAAAGGCTGGGGAGGTTTGGGGG - Intronic
943724393 2:191238060-191238082 AGAGGGCTGGTGAGGCCTGGGGG + Intergenic
943737122 2:191368400-191368422 AGCATCCTGGGGAGGCCTGGAGG - Intronic
946248686 2:218400604-218400626 AGCAGGCTGGGGAGGCTTGGAGG + Intronic
946373627 2:219295236-219295258 AACCGGCCTGGGAGGCCGGGCGG - Intronic
946995009 2:225381483-225381505 AACAGACTGGGGTGGGTTGGGGG + Intergenic
948027705 2:234791174-234791196 ACCAGGCTGGCGAGGTCTTGGGG - Intergenic
948163545 2:235844152-235844174 GACCGGCAGGGGAGGCCTGTGGG - Intronic
948500881 2:238392861-238392883 AACAGACTGGCCAGGCATGGTGG - Intronic
948568913 2:238905120-238905142 AAAAGGCTAGGGAGGCAGGGTGG - Intronic
1168758342 20:331278-331300 AGAAGGCTGGGGAGGCCCTGTGG - Intergenic
1168808788 20:689166-689188 AGCAGGCAGGGGAGGGCTGAGGG + Intergenic
1170309331 20:14975406-14975428 AGCAGGCTGGGGCGGGCAGGTGG + Intronic
1171246427 20:23613620-23613642 TACAGGCTGGGGAGCCCTGCAGG - Intergenic
1171447865 20:25217507-25217529 AGCCGGGTGGGGAGGCCTGCAGG - Exonic
1172358214 20:34294288-34294310 CACAGGCTGGGGATGCTGGGTGG + Intronic
1172991934 20:39042993-39043015 AGCAGGCTAGGGAGGCTGGGAGG + Intergenic
1173617112 20:44410486-44410508 AGCAGGCTGAGGAGGGGTGGTGG - Intronic
1174048112 20:47748150-47748172 AGCAGACAGGGGAGACCTGGTGG - Intronic
1174740345 20:53007186-53007208 ACCAGGCTGAAGTGGCCTGGTGG + Intronic
1174774109 20:53327798-53327820 AACAGGCTAGGGAGCCTGGGTGG + Intronic
1175939187 20:62530143-62530165 AGCATGCTCGGGGGGCCTGGGGG + Intergenic
1175999779 20:62826646-62826668 AACTTGCTGGGGAGCCCTAGAGG + Intronic
1176130139 20:63493340-63493362 AGCACCCTGGGGAGGCCTGAGGG - Intronic
1176229601 20:64025384-64025406 ACCGGGCTGGGGAGGCTTTGAGG + Intronic
1178597300 21:33966450-33966472 ATCAAGCCAGGGAGGCCTGGAGG - Intergenic
1179677996 21:42997809-42997831 ATCAGGCTGGGGAGGACTCAGGG + Intronic
1179983614 21:44909190-44909212 AGCGGGATGGGGAGGCCGGGGGG + Intronic
1180928883 22:19575520-19575542 AAAAGGTTGGGCAGGCGTGGTGG - Intergenic
1181042195 22:20197413-20197435 CAGAGGCTGGTGAGGCCTGCTGG + Intergenic
1181804440 22:25366443-25366465 GAGGGGCTGGGGAGGCCGGGGGG + Intronic
1182522556 22:30892567-30892589 AACAGACAAGGGAGGCTTGGTGG + Intronic
1183196761 22:36358745-36358767 AAGTGGCAGGGGAGGCCAGGAGG - Intronic
1183675462 22:39296875-39296897 AACAGGCTGGGGTGGGCTGGGGG - Intergenic
1183731563 22:39621477-39621499 GTCAGTCTGGGCAGGCCTGGCGG + Intronic
1183747957 22:39703211-39703233 AACAGGCTGAGGAGACGAGGGGG - Intergenic
1183827308 22:40398443-40398465 ATCTGGCTGTGGAGGCCTGAAGG - Intronic
1184352274 22:43952164-43952186 TACTGGCAGGGAAGGCCTGGAGG - Intronic
1184426596 22:44412373-44412395 CAGAGGCTGGGGAGGCCCTGGGG - Intergenic
1184510209 22:44928950-44928972 ACCAGGCTGGGGAGGCGAGAGGG + Intronic
1184610291 22:45599045-45599067 CCCAGGCTGGGGAGGACTTGTGG + Intronic
1184629298 22:45763300-45763322 AACTGGCTGGAGAGACTTGGAGG + Intronic
1185378279 22:50493080-50493102 AACAGCATGGGCAGGCATGGTGG + Intergenic
950746799 3:15097225-15097247 AAAAGGCTGGCCAGGCATGGTGG + Intronic
950851313 3:16064543-16064565 GACACGCTAGGGAGGCCTGTGGG + Intergenic
950935599 3:16835780-16835802 AACAGCCGTGTGAGGCCTGGTGG - Intronic
951198199 3:19847403-19847425 GACAGGGTGGCCAGGCCTGGTGG + Intergenic
951458313 3:22919169-22919191 CAGAGGCTGGGAAGGGCTGGGGG + Intergenic
951760076 3:26138043-26138065 AAATGGCTGGGGAGGCCTCGGGG - Intergenic
952111081 3:30124507-30124529 ACATGGCTGGGGAGGCCTGAGGG + Intergenic
952174265 3:30844356-30844378 AACAGGATCTGGAAGCCTGGTGG - Intronic
952861771 3:37818768-37818790 ACAGGGCTGGGGAGGCTTGGAGG - Intronic
953007531 3:38992094-38992116 AACAGACTGGCCAGGCATGGTGG - Intergenic
953387134 3:42513057-42513079 CAGAAGCAGGGGAGGCCTGGTGG + Intronic
953427997 3:42811581-42811603 GACAGGCTGGGGAGGACGGCTGG - Intronic
954366780 3:50150670-50150692 AAAAGGCTCGGGATGCCTGAGGG + Intergenic
954856638 3:53649409-53649431 AAAAGGCAGGGGTGGCCTGATGG + Intronic
955730547 3:61981060-61981082 ACATGGCTGGGGAGGCCTCGGGG + Intronic
955911495 3:63863660-63863682 AAGAGGCCGGGGAGGCCGAGGGG + Intronic
956910725 3:73813918-73813940 AACATGCTGGGAAAGTCTGGGGG + Intergenic
957857418 3:85895831-85895853 CAAAGGCTGGGGAGGCCTCATGG - Intronic
960509548 3:118531885-118531907 AACCGTCTTGGAAGGCCTGGAGG + Intergenic
961442889 3:126963134-126963156 CACAGGCTCTGCAGGCCTGGGGG + Intergenic
961453667 3:127013957-127013979 GTGAGGCTTGGGAGGCCTGGAGG + Intronic
961537437 3:127578723-127578745 AAGGGGCTGGGGAAGCCTGGAGG - Intronic
961737325 3:129010433-129010455 AACAGGGAGGAGAGGCCTGGCGG + Intronic
964747709 3:160027337-160027359 AACAGGCTGGTAAGGCAAGGAGG + Intronic
967805783 3:193713561-193713583 AGGAGGCAGGGGAGGCCTGGTGG - Intergenic
968549386 4:1214425-1214447 CACAGCCCGGGGTGGCCTGGTGG - Exonic
968646573 4:1744129-1744151 GACAGGCAGGGGAGGCCAGCAGG - Intronic
968648601 4:1751633-1751655 ACCGCGCTGGGGAGGCCTCGAGG + Intergenic
968718547 4:2180296-2180318 AAAAGGCTGGGGAGGTGGGGCGG + Intronic
968729862 4:2264604-2264626 AGCAGCCAGGAGAGGCCTGGAGG + Intergenic
968878569 4:3286940-3286962 CTCGGGCTGGGGAGGCCTCGGGG + Intergenic
968957273 4:3725820-3725842 AACAGCCAGGGGAGGGCCGGGGG - Intergenic
969531727 4:7734172-7734194 GACAGGCTGGGGACGGGTGGGGG + Intronic
970580193 4:17467832-17467854 TACAGGGTGGGGTGGCGTGGGGG - Intronic
975819524 4:78255269-78255291 TTCAGGATGGGGAGGACTGGCGG + Exonic
976130666 4:81880597-81880619 CACAGGCTGGGGCCACCTGGAGG + Intronic
977887565 4:102270971-102270993 TAGAGGATGAGGAGGCCTGGGGG + Intronic
980280912 4:130718256-130718278 AACAGGCTATGGTGGCCTGGGGG + Intergenic
980769177 4:137349909-137349931 AAGAGGCTGGGCAGGCATGGTGG + Intergenic
982095875 4:151922978-151923000 ATGAGTGTGGGGAGGCCTGGTGG + Intergenic
982437692 4:155397601-155397623 AACATCCTGGGAAGGCCAGGAGG - Intergenic
983514972 4:168646125-168646147 AAGAGGCTGTGATGGCCTGGAGG - Intronic
984645022 4:182210006-182210028 GGGAGGCTGGGGAGGGCTGGAGG - Intronic
985141937 4:186849161-186849183 ATCCAGCTGTGGAGGCCTGGGGG + Intergenic
985440616 4:189980701-189980723 AACAGGCTGGGGGAGTGTGGGGG + Intergenic
985524426 5:394869-394891 CCCAGGCTGGGGAGGACTCGGGG - Intronic
985708346 5:1414391-1414413 CACTGGGTGGGGGGGCCTGGAGG + Intronic
985721737 5:1493148-1493170 GGCTGGCTGGGGAAGCCTGGAGG - Intronic
985809929 5:2075471-2075493 CCCAGGCTGGGGAGAGCTGGAGG + Intergenic
986525746 5:8673205-8673227 ACCTGGCTGGGGAGGCCTCAGGG + Intergenic
986861481 5:11931771-11931793 AGCAGGGTGGACAGGCCTGGGGG - Intergenic
987501160 5:18710822-18710844 TTCAGCCTGGTGAGGCCTGGAGG + Intergenic
988006480 5:25418403-25418425 AGCATGCTGGGGAGGCCTCAGGG + Intergenic
988641924 5:33049810-33049832 AGGAGGCTGGGTAGTCCTGGGGG - Intergenic
989325119 5:40183516-40183538 TACAGGCTGGCCAGGCATGGTGG - Intergenic
990325889 5:54674950-54674972 AACAGCCGGGTGAGGCCTGAAGG + Intergenic
991087418 5:62660844-62660866 TACAGGATGGGGTGGCATGGTGG - Intergenic
992712352 5:79471871-79471893 AACATGCTGGGCAGACCTGAAGG - Intronic
993991075 5:94659960-94659982 AATAGGCTGAGCAGGCCAGGTGG + Intronic
997470156 5:134113180-134113202 AAGAGGCTGGGGAGACCTAATGG + Intergenic
997847773 5:137303773-137303795 ACCAGGCTGGGGCAGCCAGGAGG + Intronic
997848446 5:137309371-137309393 ACCAGGCTGGGGCGGCCAAGAGG - Intronic
998038763 5:138937674-138937696 GACAGGCTGGGGAGGCACAGTGG - Intergenic
998807884 5:145936705-145936727 AGCGGGCTGGGGAGGCGTGTGGG - Intronic
999309798 5:150544774-150544796 AGCAGGCTGGGGAGGGGTTGTGG + Intronic
999373528 5:151070736-151070758 AATTGGTTGGGGAGGACTGGAGG - Intronic
1000232931 5:159331948-159331970 CAAAGTCTGGGGAGGCCTAGAGG - Intergenic
1001116655 5:168946279-168946301 AAGAGGCTGGGGAGGCTGAGAGG - Intronic
1001629642 5:173165214-173165236 AGCAGCCTGGCCAGGCCTGGGGG + Intergenic
1001999427 5:176189403-176189425 GACAGGAGGGGGTGGCCTGGAGG + Intergenic
1002068135 5:176662727-176662749 AACAGCCTTGGCAGGGCTGGGGG - Intergenic
1002098846 5:176847401-176847423 AACAGGCTGCCGAGGCGGGGGGG + Intronic
1002439567 5:179257339-179257361 TCCAGGCTGCGGGGGCCTGGAGG + Intronic
1002783912 6:386889-386911 AGGAGGCCGGGGAGGCCTCGGGG - Intergenic
1003403855 6:5812064-5812086 GACCTGATGGGGAGGCCTGGTGG - Intergenic
1005882010 6:30069245-30069267 AGGAGGCTGGGGAGGGGTGGTGG - Exonic
1005997005 6:30937504-30937526 AAGAGGCGGGGGAGTGCTGGAGG + Intergenic
1006060219 6:31413551-31413573 AAGAGGCTGGGGTGTCCAGGAGG + Intronic
1006424145 6:33953718-33953740 CAGAGGCTGGGGTGACCTGGGGG + Intergenic
1006510028 6:34516575-34516597 CAGGGGCTGGTGAGGCCTGGAGG + Intronic
1006852119 6:37106367-37106389 ACCAGGCTGGCCAGGCGTGGTGG + Intergenic
1007183094 6:39944902-39944924 AAGATGGAGGGGAGGCCTGGTGG - Intergenic
1007253738 6:40514041-40514063 AACCGGCTGGGGAGTCTTGGTGG + Intronic
1007337534 6:41164194-41164216 AAGAGGCTGGAGAAGCCTGCAGG + Intergenic
1007339832 6:41184265-41184287 AACAGCCTGGGCAGCCCTGAGGG - Intergenic
1007715820 6:43855529-43855551 CTCAGGCTGGAGAGGCCTGCAGG + Intergenic
1007796498 6:44352839-44352861 GACACTCTGGGGAGGCCAGGAGG - Exonic
1007833207 6:44654598-44654620 AAAACGCTGGAGGGGCCTGGAGG + Intergenic
1012627259 6:101419361-101419383 AAGAGGCTAGGGAGGGGTGGAGG + Intronic
1013340599 6:109211219-109211241 AACATGCTGGCCAGGCGTGGTGG - Intergenic
1015200603 6:130575704-130575726 TACAGGCTGGGGAGGCAAGGAGG + Intergenic
1015238256 6:130995047-130995069 AACAGGCCGGCCAGGCGTGGTGG + Intronic
1015245837 6:131073898-131073920 ACTTGGCTGGGGAGGCCTGAGGG - Intergenic
1015575597 6:134667516-134667538 AACAAGTTGGGGAGGCTTGGAGG + Intergenic
1016796706 6:148125581-148125603 AAAAGGCCTGAGAGGCCTGGGGG + Intergenic
1017016476 6:150104931-150104953 AACAGGCAGGCCAGGCATGGTGG - Intergenic
1017696674 6:157022129-157022151 AACAGGGCGGGGAGGCGGGGCGG + Intronic
1018098575 6:160415795-160415817 AACAGGCTGGGGTTGGCAGGTGG - Intronic
1018400676 6:163415765-163415787 AGCAGGCTCGGGAGGCCGAGCGG - Intronic
1018627721 6:165795901-165795923 AACAGTCTGAGGAGGTATGGAGG - Intronic
1018692260 6:166356473-166356495 AAAAGGCTGGCCAGGCATGGTGG + Intergenic
1019024811 6:168950628-168950650 CACAGGCTGTGCAGCCCTGGAGG + Intergenic
1019611883 7:1940932-1940954 AAGAGGAGGGTGAGGCCTGGGGG - Intronic
1019644292 7:2120874-2120896 AACAGGCTGGTGTGGCCTCCAGG + Intronic
1019788189 7:2992994-2993016 GACAGACTGGCCAGGCCTGGTGG - Intronic
1020275849 7:6623924-6623946 ACCAGGCTGTGGAGGTTTGGAGG + Exonic
1020438385 7:8189993-8190015 GACGGGCTCAGGAGGCCTGGTGG + Intronic
1022473839 7:30697833-30697855 GACAGGATGGGGGAGCCTGGTGG - Intronic
1022483398 7:30759087-30759109 AGCCGGGTGGGGAGACCTGGTGG - Intronic
1023561345 7:41476305-41476327 AACAGGAGGGGGAGACATGGAGG + Intergenic
1023902164 7:44490318-44490340 AACAGGCTGGGAGAGCTTGGAGG + Intronic
1024476832 7:49820886-49820908 TACAGGCTGAGGAAGGCTGGCGG + Intronic
1024508690 7:50185328-50185350 CAAAGGCTGGGGAGCCCTTGAGG - Intergenic
1024613326 7:51085465-51085487 CACAGGCAGGGGAGGCCATGAGG + Intronic
1026473896 7:70717694-70717716 AAGAGGCTGGCGAGGGCTTGAGG - Intronic
1029256773 7:99274616-99274638 AACAGGCGGGGAAAGCCAGGCGG - Intergenic
1029446381 7:100615145-100615167 ACCATGGTGAGGAGGCCTGGAGG - Exonic
1029492865 7:100881826-100881848 AAGAGGGTTGGTAGGCCTGGGGG + Intronic
1029557647 7:101281443-101281465 GAAAGGCTGGGAAGGCCAGGTGG + Intergenic
1029977168 7:104845665-104845687 AAGGAGCTGGGGAGTCCTGGGGG + Intronic
1030207736 7:106967039-106967061 CACAGGATGGGGGGGCATGGTGG + Intergenic
1031123055 7:117742952-117742974 AGCAGGCTGGGCAGGGCTGCAGG - Intronic
1033136566 7:138789533-138789555 AACAAGCTGGCCAGGCATGGTGG - Intronic
1033243714 7:139701815-139701837 AACTGGGTTTGGAGGCCTGGAGG + Intronic
1033543275 7:142376491-142376513 AGCAGGCAGGGGTGGCCTGCAGG + Intergenic
1034275938 7:149823890-149823912 AATAGGGCAGGGAGGCCTGGGGG + Intergenic
1034550494 7:151817516-151817538 GACAGCCTTGGGAAGCCTGGGGG - Intronic
1035438538 7:158877978-158878000 ATGAGGCTGTGGAGGCCAGGAGG + Intronic
1035714619 8:1744431-1744453 AACGGGCTGGCGTGGCCGGGAGG + Intergenic
1037827370 8:22167443-22167465 AGCAGGCTGAGAAGGTCTGGGGG + Intronic
1038189379 8:25305066-25305088 CACAGGCAGTGGAGGCCTAGTGG + Intronic
1038690069 8:29753216-29753238 AACAGGCAGGCCAGGCATGGTGG - Intergenic
1038898793 8:31818630-31818652 AACAGGCTGCGGAGCTCAGGAGG + Intronic
1039516631 8:38139196-38139218 AAAAGGCTGGGTAGGACTGCGGG + Exonic
1040830981 8:51676591-51676613 AACAGGATAGGGAGGACTGGTGG - Intronic
1042669585 8:71246916-71246938 AAGAGGGTGGGGAGTGCTGGAGG - Intronic
1043392109 8:79801819-79801841 AACAAGCAGGAGAGACCTGGAGG - Intergenic
1044264037 8:90161793-90161815 AACAGGCTGGAGAGGCCTAGTGG + Intergenic
1045238520 8:100377414-100377436 AGAAGGCTGGGGAGGCAGGGTGG + Intronic
1045239258 8:100384599-100384621 CAGAGCCTGGGGAAGCCTGGCGG - Intronic
1045545094 8:103121474-103121496 AAGAGGGTGGGGAGGGTTGGAGG + Intergenic
1045582417 8:103496461-103496483 AACAGGCTGGCTGGGCATGGTGG - Intergenic
1047967373 8:130056350-130056372 ATCAGCCTGGGGAGGCCCAGGGG - Intronic
1048845577 8:138601422-138601444 AACAAGCGGGGGTGGGCTGGGGG + Intronic
1049097725 8:140558724-140558746 ACCCGGCTGGGGTGGCCTGGGGG - Intronic
1049170187 8:141155169-141155191 AACATTCTGGGGATGGCTGGGGG + Intronic
1049265542 8:141666057-141666079 AGCAGCGTGGGAAGGCCTGGGGG - Intergenic
1049308868 8:141922851-141922873 AACCGGATGGGAAGCCCTGGGGG - Intergenic
1049574310 8:143383415-143383437 AGCAGGCTGGGGAGGGCTGGGGG - Exonic
1049586330 8:143434255-143434277 AACAGCCTGACGATGCCTGGTGG - Intergenic
1049587236 8:143437738-143437760 ACCTGGGTGGGGAGGGCTGGGGG + Exonic
1049613725 8:143567483-143567505 CTCAGGCTGGGGAGCCCAGGAGG + Intronic
1049777369 8:144413025-144413047 AACAGGTGGGCGGGGCCTGGTGG - Intronic
1050176681 9:2876016-2876038 AGCACGCAGGGGAGCCCTGGAGG - Intergenic
1052152054 9:25129173-25129195 AACAGGCTGGCCAGGCGCGGTGG + Intergenic
1055169806 9:73242374-73242396 TACAGGCATGTGAGGCCTGGAGG - Intergenic
1055856737 9:80697231-80697253 TGGAGGTTGGGGAGGCCTGGTGG - Intergenic
1056329838 9:85512089-85512111 CAGAGGCTGGGGTGGCCTGGTGG - Intergenic
1056955373 9:91076841-91076863 TACAGGCTGTGGAGCCCTGAGGG - Intergenic
1060111487 9:120909871-120909893 AACTGGCTGGGGTCCCCTGGAGG + Intronic
1060111504 9:120909934-120909956 AACTGGCTGGGGTCCCCTGGAGG + Intronic
1060246550 9:121951339-121951361 AATAGGCTGGGAATACCTGGTGG - Intronic
1060267400 9:122120374-122120396 AGCAGGCAGGGAAGGGCTGGGGG - Intergenic
1060282209 9:122222177-122222199 AGCAGGCTGGGGGAGCCAGGTGG + Intronic
1060876783 9:127089648-127089670 TACAAGCTGGGGAGGACTGGAGG - Intronic
1061401768 9:130372363-130372385 ACGAGGCTGGGGAGGCACGGAGG + Intronic
1061584667 9:131558084-131558106 CCCAGGCTGAGGAGGCCTCGCGG + Intergenic
1061629962 9:131866115-131866137 AGCAGGCTGGGGAGGGTTTGGGG - Intronic
1061857617 9:133450884-133450906 TGCAGTGTGGGGAGGCCTGGGGG + Intronic
1062036930 9:134386518-134386540 GAGAGGCTGGGGAGGTATGGGGG + Intronic
1062041238 9:134405212-134405234 GCCAGGATGGGGAGGCCAGGCGG - Intronic
1062114662 9:134801975-134801997 ACCACGCCGGGGGGGCCTGGAGG - Exonic
1062138695 9:134943788-134943810 AAATGGCTGGGGAGGTCCGGGGG + Intergenic
1062292824 9:135804934-135804956 AGGAGGCTTGGGAGGGCTGGGGG - Intergenic
1062741708 9:138178933-138178955 AACAGGCTGGGGGAGTGTGGGGG - Intergenic
1185645145 X:1610548-1610570 TAGGGGCAGGGGAGGCCTGGAGG - Intergenic
1186497342 X:10022110-10022132 AACAGCATGGTGAGGCCTCGTGG - Intronic
1187423852 X:19160060-19160082 AAAAGGCAGAGGAGGGCTGGGGG + Intergenic
1187468092 X:19543761-19543783 GACTGGCGGGGGAGGCCTGATGG + Intronic
1190582610 X:51903474-51903496 AACAGGCAGGGGAGGCGTTGGGG - Intergenic
1190736196 X:53257067-53257089 AACACGCAGGTGAGGCATGGAGG + Intronic
1191254651 X:58274505-58274527 AAGAGGCTGGGGTGCCCTGCCGG - Intergenic
1192144132 X:68669616-68669638 AAGTGGCTGAGGTGGCCTGGTGG + Intronic
1194379340 X:93175076-93175098 TTCAGGCTAGGGAGGCCTGAAGG + Intergenic
1194750399 X:97678070-97678092 GACAGGCTGGGAAGGTCTGTGGG - Intergenic
1195124419 X:101791691-101791713 TCAAGGCTGGGGAGGGCTGGGGG + Intergenic
1199057896 X:143319278-143319300 AACAGGCTTGGGAGTGTTGGCGG - Intergenic
1199461894 X:148094101-148094123 TGCAGGCTGGGGAGGCCTCAGGG + Intergenic
1199702741 X:150396281-150396303 AAGAGGCTAGGTAGGCATGGTGG - Intronic
1199846004 X:151693798-151693820 CACAGGCTCCGGAGGCATGGGGG + Intergenic
1200114268 X:153763302-153763324 ATGGGGCTGGGGAGGCCTGGGGG - Intergenic
1200213699 X:154358164-154358186 CACAGGCAGGGGAGGCAGGGGGG - Intronic