ID: 1062975969

View in Genome Browser
Species Human (GRCh38)
Location 10:1682956-1682978
Sequence CCGCGGTGCTGTGTTACCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062975969_1062975975 -1 Left 1062975969 10:1682956-1682978 CCGGCGGTAACACAGCACCGCGG No data
Right 1062975975 10:1682978-1683000 GAGGTGGGCTAAGAAGCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062975969 Original CRISPR CCGCGGTGCTGTGTTACCGC CGG (reversed) Intronic