ID: 1062975969

View in Genome Browser
Species Human (GRCh38)
Location 10:1682956-1682978
Sequence CCGCGGTGCTGTGTTACCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 42}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062975969_1062975975 -1 Left 1062975969 10:1682956-1682978 CCGGCGGTAACACAGCACCGCGG 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1062975975 10:1682978-1683000 GAGGTGGGCTAAGAAGCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062975969 Original CRISPR CCGCGGTGCTGTGTTACCGC CGG (reversed) Intronic
901786751 1:11629823-11629845 CTGCGGTGCTGTGTGAGAGCAGG + Intergenic
901821982 1:11836073-11836095 CCGCGGTTCTCTGTGACCACCGG - Exonic
901836257 1:11925982-11926004 GCGCGGTGAGGTGGTACCGCTGG - Exonic
906950819 1:50333423-50333445 CTGCGGTGCTGTGTGACCTTGGG - Intergenic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
924724048 1:246651269-246651291 CCACGCTGCTGTGCTATCGCAGG + Intronic
1062975969 10:1682956-1682978 CCGCGGTGCTGTGTTACCGCCGG - Intronic
1064014102 10:11759566-11759588 CTGTGGTGCTGTGTTCCAGCAGG + Intronic
1102029315 12:109730861-109730883 CCCCGCTGCTGTGTGACTGCAGG + Intronic
1102257575 12:111425119-111425141 CCGACCTGCTGTGTGACCGCGGG + Intronic
1103895338 12:124269435-124269457 CCGCGGGGCTGTGTTCCTGGTGG - Intronic
1107605071 13:42048740-42048762 GGGCGGTGCTGTGTCCCCGCAGG + Exonic
1123004570 14:105315049-105315071 CCGCCGCGCTTTGTTCCCGCCGG + Exonic
1141769579 16:86081507-86081529 CAGCCGTGCTGTGTGACCACGGG - Intergenic
1142721428 17:1778616-1778638 CCTGGTTGCTGTGTTACCACTGG - Intergenic
1146022496 17:29292531-29292553 CCGGGGAGCTGGGTTCCCGCTGG + Intronic
1148172271 17:45532245-45532267 CCCCAGTGCTGTCTTCCCGCAGG - Intergenic
1148276995 17:46313208-46313230 CCCCAGTGCTGTCTTCCCGCAGG + Intronic
1148299112 17:46530792-46530814 CCCCAGTGCTGTCTTCCCGCAGG + Intronic
1150403477 17:64879161-64879183 CCCCAGTGCTGTCTTCCCGCAGG - Intronic
1163158817 19:15452988-15453010 TCGCTGTGCTGTGTGACCCCAGG - Intronic
1168676215 19:58279585-58279607 CCGCGGTGCTGGGGTCCCGGTGG - Exonic
933996880 2:87676559-87676581 CTCCGGTGCTGTGTTTCCACGGG - Intergenic
934032844 2:88064084-88064106 CCGCAGGGCTGTGTTCCCTCTGG + Intergenic
934685931 2:96321753-96321775 CCGCGATGCGCTGTTCCCGCTGG - Intergenic
936296971 2:111274351-111274373 CTCCGGTGCTGTGTTTCCACGGG + Intergenic
938467669 2:131533963-131533985 CTGCGGTGCTGTGTCAGGGCAGG - Intergenic
946843087 2:223837229-223837251 CCGCGGCGCCGCGTTGCCGCAGG + Intronic
1169877884 20:10317750-10317772 CCGTGGTGCTGTACTACTGCAGG - Intergenic
1183170211 22:36182315-36182337 CTGTGGTGCTTTGTTACAGCAGG - Intergenic
1183175514 22:36222240-36222262 CAGTGGTGCTTTGTTACAGCAGG - Intergenic
1183407895 22:37639494-37639516 CCCCGCTGCTGTGTGTCCGCCGG - Exonic
972751262 4:41991067-41991089 CCGCGGAGGTGAGTAACCGCGGG - Intronic
985643804 5:1075722-1075744 CCGAGGTGCTGTGTGCACGCTGG - Intronic
986335063 5:6748537-6748559 CAGCCATGCTGTGTCACCGCTGG + Exonic
990772875 5:59269541-59269563 CTGCAGTGCTGCCTTACCGCGGG - Intronic
999123807 5:149231207-149231229 CGGCTGTGCTTTGTTACTGCAGG - Intronic
1011649292 6:89491112-89491134 CGGCGGAGCTGTGTTCCCTCTGG - Intronic
1012895262 6:104940501-104940523 CCGCGGTGGAGCTTTACCGCGGG - Intergenic
1019524011 7:1472695-1472717 CTGCGGTGCCGTGTCACCTCAGG + Intronic
1052358623 9:27529853-27529875 CCACGGTGCTGCCATACCGCAGG - Intergenic
1053308614 9:37001446-37001468 CTGCGGTGCTGTGTTGCTGCAGG - Intronic
1057290894 9:93806897-93806919 CTGAGGTGCTGTGTGACCCCTGG + Intergenic
1062346635 9:136118202-136118224 CGGCGGAGCTGTGTCCCCGCAGG + Intronic