ID: 1062975975

View in Genome Browser
Species Human (GRCh38)
Location 10:1682978-1683000
Sequence GAGGTGGGCTAAGAAGCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062975968_1062975975 6 Left 1062975968 10:1682949-1682971 CCGAATGCCGGCGGTAACACAGC No data
Right 1062975975 10:1682978-1683000 GAGGTGGGCTAAGAAGCACGTGG No data
1062975967_1062975975 7 Left 1062975967 10:1682948-1682970 CCCGAATGCCGGCGGTAACACAG No data
Right 1062975975 10:1682978-1683000 GAGGTGGGCTAAGAAGCACGTGG No data
1062975969_1062975975 -1 Left 1062975969 10:1682956-1682978 CCGGCGGTAACACAGCACCGCGG No data
Right 1062975975 10:1682978-1683000 GAGGTGGGCTAAGAAGCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062975975 Original CRISPR GAGGTGGGCTAAGAAGCACG TGG Intronic