ID: 1062980477

View in Genome Browser
Species Human (GRCh38)
Location 10:1718330-1718352
Sequence GACCGTCCATGCATGTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062980477_1062980487 22 Left 1062980477 10:1718330-1718352 CCCACCCACATGCATGGACGGTC No data
Right 1062980487 10:1718375-1718397 TGCTTCCTCCCAGTGTTCTTGGG No data
1062980477_1062980484 -5 Left 1062980477 10:1718330-1718352 CCCACCCACATGCATGGACGGTC No data
Right 1062980484 10:1718348-1718370 CGGTCAGGCTTCTGCTGGTAGGG No data
1062980477_1062980485 -2 Left 1062980477 10:1718330-1718352 CCCACCCACATGCATGGACGGTC No data
Right 1062980485 10:1718351-1718373 TCAGGCTTCTGCTGGTAGGGAGG No data
1062980477_1062980486 21 Left 1062980477 10:1718330-1718352 CCCACCCACATGCATGGACGGTC No data
Right 1062980486 10:1718374-1718396 CTGCTTCCTCCCAGTGTTCTTGG No data
1062980477_1062980482 -10 Left 1062980477 10:1718330-1718352 CCCACCCACATGCATGGACGGTC No data
Right 1062980482 10:1718343-1718365 ATGGACGGTCAGGCTTCTGCTGG No data
1062980477_1062980483 -6 Left 1062980477 10:1718330-1718352 CCCACCCACATGCATGGACGGTC No data
Right 1062980483 10:1718347-1718369 ACGGTCAGGCTTCTGCTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062980477 Original CRISPR GACCGTCCATGCATGTGGGT GGG (reversed) Intronic