ID: 1062981116

View in Genome Browser
Species Human (GRCh38)
Location 10:1723873-1723895
Sequence CAGTGATGCTACAGGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062981110_1062981116 18 Left 1062981110 10:1723832-1723854 CCAAAAGTATTTCTCACCCTGGA 0: 1
1: 0
2: 1
3: 11
4: 149
Right 1062981116 10:1723873-1723895 CAGTGATGCTACAGGGATGAAGG No data
1062981112_1062981116 2 Left 1062981112 10:1723848-1723870 CCCTGGAGACGTGATGGTTTTCT 0: 1
1: 0
2: 0
3: 10
4: 134
Right 1062981116 10:1723873-1723895 CAGTGATGCTACAGGGATGAAGG No data
1062981113_1062981116 1 Left 1062981113 10:1723849-1723871 CCTGGAGACGTGATGGTTTTCTA 0: 1
1: 0
2: 1
3: 28
4: 280
Right 1062981116 10:1723873-1723895 CAGTGATGCTACAGGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062981116 Original CRISPR CAGTGATGCTACAGGGATGA AGG Intronic
No off target data available for this crispr