ID: 1062982538

View in Genome Browser
Species Human (GRCh38)
Location 10:1737226-1737248
Sequence CTCAAGCTTCGCAGCAGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062982538_1062982546 9 Left 1062982538 10:1737226-1737248 CCGCCGCTGCTGCGAAGCTTGAG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1062982546 10:1737258-1737280 CCGGGAGCGGCTCACTTTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 35
1062982538_1062982547 19 Left 1062982538 10:1737226-1737248 CCGCCGCTGCTGCGAAGCTTGAG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1062982547 10:1737268-1737290 CTCACTTTTCAGGACTGAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 159
1062982538_1062982541 -10 Left 1062982538 10:1737226-1737248 CCGCCGCTGCTGCGAAGCTTGAG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1062982541 10:1737239-1737261 GAAGCTTGAGGTTGCAAACCCGG 0: 1
1: 0
2: 0
3: 9
4: 127
1062982538_1062982542 -9 Left 1062982538 10:1737226-1737248 CCGCCGCTGCTGCGAAGCTTGAG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1062982542 10:1737240-1737262 AAGCTTGAGGTTGCAAACCCGGG 0: 1
1: 0
2: 1
3: 16
4: 142
1062982538_1062982543 -4 Left 1062982538 10:1737226-1737248 CCGCCGCTGCTGCGAAGCTTGAG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1062982543 10:1737245-1737267 TGAGGTTGCAAACCCGGGAGCGG 0: 1
1: 0
2: 0
3: 12
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062982538 Original CRISPR CTCAAGCTTCGCAGCAGCGG CGG (reversed) Exonic
907176823 1:52531925-52531947 CTCCAGCTTGGCAGCAGAGTGGG - Intronic
909051839 1:70776017-70776039 CTGAAGCTTAACAGCAGTGGGGG - Intergenic
916194516 1:162210916-162210938 CTCCAGCATCACAGCAGCTGCGG - Intronic
924805882 1:247361259-247361281 CTTCAGCTTCCCAGCAGTGGTGG + Intergenic
1062982538 10:1737226-1737248 CTCAAGCTTCGCAGCAGCGGCGG - Exonic
1063091657 10:2870795-2870817 CTGGAGCTTCTCAGCAGCGATGG + Intergenic
1063208385 10:3856121-3856143 CTCAACCTCCCCAGCAGCAGGGG - Intergenic
1065232755 10:23615299-23615321 CTCTAGCTTCTCAGCACTGGTGG - Intergenic
1072227941 10:93387442-93387464 CTCAGGCTTCCCAGCACAGGAGG - Intronic
1072243495 10:93520024-93520046 CTCCAGCATCACAGCAGCTGGGG - Intronic
1073654105 10:105393807-105393829 CTTAAGCTTCACAGCAGCATTGG + Intergenic
1077213333 11:1383423-1383445 TTCCAGTTCCGCAGCAGCGGAGG + Intergenic
1077225235 11:1436654-1436676 GTCAGGCTTCCCAGCAGCCGGGG - Intronic
1082814302 11:57498205-57498227 CTCAAGCTTCCCACCAGCTTCGG - Intronic
1083605216 11:63974696-63974718 GTCAAGCCCCGCAGCAGCAGCGG - Exonic
1084308015 11:68299203-68299225 CTCCAGCTTCACAGCAGGGTGGG - Intergenic
1084362725 11:68679437-68679459 CATGAGCTTCTCAGCAGCGGTGG + Intergenic
1088307046 11:108421769-108421791 CTCCAGCTTGGCAGCAGCTGTGG - Intronic
1089794731 11:120971007-120971029 CTCAACCTTCGCAACAGCCCTGG - Intronic
1090881087 11:130831781-130831803 ATCAAGTTTCGGAGCAGGGGTGG - Intergenic
1094603907 12:31934249-31934271 CTCAACCTTCGGAGTAGCTGTGG - Intergenic
1095993999 12:48062943-48062965 CTCAAGCTTCACAGCTGTGGAGG - Intronic
1098595874 12:72272760-72272782 CTCACCCTTCGCAGCCGCGATGG + Exonic
1103037413 12:117667608-117667630 CTCAAGATCCACAGCAGCGTAGG - Exonic
1105214417 13:18275977-18275999 CTGAAGCCTGGCAGCAGCTGAGG + Intergenic
1106257361 13:28033545-28033567 CTCAGGCTCCTCAGCAGCTGGGG - Intronic
1117328609 14:54691018-54691040 CTCCAGCTTCTCAGCAGTGCAGG + Intronic
1122194269 14:100073436-100073458 CTCAGGCTTCTGAGCAGCTGGGG + Intronic
1122807349 14:104266647-104266669 GTGAAGCATCGCAGCAGTGGGGG + Intergenic
1123191303 14:106574944-106574966 CTCAAGCTTCACATCAGTGGAGG + Intergenic
1125604793 15:40933907-40933929 CTCAGCCTTCCCAGCAGCTGGGG - Intronic
1129032423 15:72628856-72628878 CTCACGCCACGCAGCAGCTGGGG - Intergenic
1129698642 15:77754929-77754951 CTCAAGCTTCACAACAGCGTTGG - Intronic
1129843197 15:78756373-78756395 CTCCAGTTGCCCAGCAGCGGTGG - Intergenic
1130632188 15:85580617-85580639 CTGAAGCTCTGCAGCAGTGGAGG - Exonic
1132659541 16:1055235-1055257 CTCAAGGCTCCCAGCAGCGCCGG - Intergenic
1132915304 16:2340651-2340673 CTCCAGCCTCGCAGTGGCGGCGG + Exonic
1141607573 16:85163474-85163496 CCCAAGCTTCCCAGCCACGGAGG - Intergenic
1141910672 16:87056606-87056628 CCCAAGCATCGCAGCATCGGGGG - Intergenic
1142321444 16:89385804-89385826 CTCTGGCTGCGCAGCGGCGGGGG - Intronic
1147318295 17:39631549-39631571 CCCAACCTCCGCAGGAGCGGAGG - Intronic
1147342067 17:39758611-39758633 CTCAAGTTTTGGAGCAGCGGGGG + Intergenic
1148452697 17:47790261-47790283 CACCAGCTTCGCAGGAGCAGCGG - Intergenic
1152270780 17:79323615-79323637 CCCAAGCCTCCCTGCAGCGGGGG + Intronic
1152684132 17:81685524-81685546 CCCCAGCTTGGCAGCAGCTGGGG - Intronic
1153323425 18:3794772-3794794 CTCAATCTATTCAGCAGCGGAGG + Intronic
1154021586 18:10668256-10668278 TTCCAGCTTCGCAGCACTGGAGG - Intronic
1155083023 18:22429408-22429430 CTCAGGCTGGGCAGTAGCGGTGG + Intergenic
1157476423 18:48026521-48026543 CTTAAGCTTTGCAGCACCTGTGG - Intergenic
1163627343 19:18397699-18397721 CTCAAGGTTCTCACCAGAGGTGG + Intergenic
1165732779 19:38157207-38157229 ATCAGGCTTCGCAGCAGATGTGG + Intronic
1167233064 19:48297450-48297472 GTCCAGCTTCGCGGCGGCGGCGG + Exonic
929622715 2:43372816-43372838 CTCAATCTCCGCAGTAGCTGGGG + Intronic
933773516 2:85758473-85758495 CCCAAGCTCCGCAGCAACAGCGG - Intronic
934299906 2:91770762-91770784 CTGAAGCCTGGCAGCAGCTGAGG - Intergenic
936038305 2:109129581-109129603 CTCGCTCTGCGCAGCAGCGGCGG - Exonic
940672002 2:156681875-156681897 CTCATGCTGAGCAGCAGCAGTGG + Intergenic
944527404 2:200634021-200634043 CTCAACCTTCACAGTAGGGGTGG + Intronic
945922466 2:215769689-215769711 GTCAAGCTTTGCAGTAGCAGTGG + Intergenic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1174049496 20:47757900-47757922 TTCCAGCTCCCCAGCAGCGGGGG + Intronic
1181698257 22:24604858-24604880 CTGAAGCCTGGCAGCAGCTGAGG - Intronic
1184192957 22:42907274-42907296 CTGAAGCTTCCCAGCAGGGCAGG + Intronic
960847747 3:122020632-122020654 CTCAAACTCCACAGCAGCTGGGG - Intronic
961369328 3:126419927-126419949 CTGAAGCTTGGCTGCAGCTGAGG + Intronic
967963719 3:194944506-194944528 CTCAGCCTTCCCAGCAGCTGGGG + Intergenic
968290788 3:197538179-197538201 CTCCATCTTCCCAGAAGCGGAGG + Intronic
968616454 4:1579637-1579659 CTCACGCCTCGCAGCGGCGCTGG - Intergenic
971373773 4:26039651-26039673 CTCATGCTACTCAGCAGCAGAGG + Intergenic
972960714 4:44448663-44448685 CTCAGGGTTCGGGGCAGCGGCGG + Exonic
985517425 5:354206-354228 CTGAAGCTGCGCAGCTGCTGAGG + Intronic
985609353 5:878310-878332 CTCAAGCTGCACAGCAGCCAAGG + Intronic
986306408 5:6520065-6520087 CTCAAGCTTCCCAGCCAGGGAGG + Intergenic
990635402 5:57720663-57720685 CTCAACCTCCTCAGCAGCTGGGG + Intergenic
995836802 5:116407457-116407479 CTCCAGCTTCTCAGCAGAGCAGG + Intronic
996744077 5:126830271-126830293 CCCAAGGCTCGCAGCAGGGGCGG + Intronic
999838410 5:155399216-155399238 GTCAAGCTTCGCCTCAGCAGAGG - Intergenic
1000721155 5:164709059-164709081 CTGAAGGTTCACAGCAGCGCCGG + Intergenic
1002824803 6:763185-763207 CTCCAGCTTTGCAGCTGCCGTGG + Intergenic
1002913595 6:1510448-1510470 CTCCAGCTTCACACCAGTGGGGG - Intergenic
1012170833 6:96015656-96015678 CCCAAGCTTGGCAGCAGCCGCGG - Intergenic
1015127121 6:129767447-129767469 CTGCAGCGGCGCAGCAGCGGGGG - Intergenic
1017006111 6:150029020-150029042 CTCCAGGTTCCCAGCAGCAGTGG + Intergenic
1020513097 7:9084248-9084270 CTGGAGCTTAGCAGCAGCAGTGG + Intergenic
1021855044 7:24846944-24846966 CTCAGCCTTCCCAGCAGCTGGGG - Intronic
1022643552 7:32210106-32210128 CTAAAGCTTCTCAGCAGGGCAGG + Intronic
1023118456 7:36885491-36885513 CTCTAGCTGGGCAGCAGCGGAGG + Intronic
1024835642 7:53514797-53514819 CTCAAACTTGCCAGGAGCGGTGG - Intergenic
1030230917 7:107207561-107207583 CTCAAGCTCTGTAACAGCGGTGG - Intronic
1031624803 7:123980082-123980104 CACTAGCTTAGCAGCAGTGGAGG - Intergenic
1036668597 8:10764761-10764783 CTGAAGCTTGGCAGAGGCGGGGG + Intronic
1037882354 8:22579334-22579356 CTGGAGCCTCGCATCAGCGGGGG + Exonic
1039971779 8:42326519-42326541 CTGAACCATCGCAGCAGAGGTGG + Intronic
1040290772 8:46122971-46122993 CTCAAGCTTTACATCAGCCGGGG + Intergenic
1048639315 8:136335450-136335472 CTCAGGCTTCTGAGCAGCTGGGG + Intergenic
1049015558 8:139917655-139917677 CTCCATCTTCGCAGCAGCCCTGG + Intronic
1049119265 8:140719528-140719550 CTTAATCCTCCCAGCAGCGGAGG - Intronic
1055132779 9:72794249-72794271 CTCCAACTTGGCAGCAGCAGAGG - Intronic
1059906471 9:118991975-118991997 TTTAAGCTTCCCAGCAGCTGGGG + Intergenic
1185468753 X:370406-370428 CTCACGCCTCGCTGCAGCCGTGG - Intronic
1186623434 X:11265886-11265908 CCCAAGATTCACAGTAGCGGAGG - Intronic