ID: 1062985104

View in Genome Browser
Species Human (GRCh38)
Location 10:1761344-1761366
Sequence CACAGGGATAGGCATGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062985104_1062985113 8 Left 1062985104 10:1761344-1761366 CCTTTTTCATGCCTATCCCTGTG No data
Right 1062985113 10:1761375-1761397 TGGATTATAGTCAGGACCCGGGG No data
1062985104_1062985112 7 Left 1062985104 10:1761344-1761366 CCTTTTTCATGCCTATCCCTGTG No data
Right 1062985112 10:1761374-1761396 ATGGATTATAGTCAGGACCCGGG No data
1062985104_1062985111 6 Left 1062985104 10:1761344-1761366 CCTTTTTCATGCCTATCCCTGTG No data
Right 1062985111 10:1761373-1761395 GATGGATTATAGTCAGGACCCGG No data
1062985104_1062985110 0 Left 1062985104 10:1761344-1761366 CCTTTTTCATGCCTATCCCTGTG No data
Right 1062985110 10:1761367-1761389 CTGGATGATGGATTATAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062985104 Original CRISPR CACAGGGATAGGCATGAAAA AGG (reversed) Intergenic
No off target data available for this crispr