ID: 1062985165

View in Genome Browser
Species Human (GRCh38)
Location 10:1761625-1761647
Sequence AACTCATGTCCCTAGTTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062985165_1062985168 10 Left 1062985165 10:1761625-1761647 CCTCCTAACTAGGGACATGAGTT No data
Right 1062985168 10:1761658-1761680 ACAAAGCTGCATATGTACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062985165 Original CRISPR AACTCATGTCCCTAGTTAGG AGG (reversed) Intergenic
No off target data available for this crispr