ID: 1062987261

View in Genome Browser
Species Human (GRCh38)
Location 10:1780285-1780307
Sequence AGGTGGGCAGGTGTATGTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062987251_1062987261 17 Left 1062987251 10:1780245-1780267 CCCGGGAAGACATGGACTCCAGA No data
Right 1062987261 10:1780285-1780307 AGGTGGGCAGGTGTATGTCCCGG No data
1062987252_1062987261 16 Left 1062987252 10:1780246-1780268 CCGGGAAGACATGGACTCCAGAG No data
Right 1062987261 10:1780285-1780307 AGGTGGGCAGGTGTATGTCCCGG No data
1062987255_1062987261 -1 Left 1062987255 10:1780263-1780285 CCAGAGGAGGCTCCGAACAGTCA No data
Right 1062987261 10:1780285-1780307 AGGTGGGCAGGTGTATGTCCCGG No data
1062987250_1062987261 18 Left 1062987250 10:1780244-1780266 CCCCGGGAAGACATGGACTCCAG No data
Right 1062987261 10:1780285-1780307 AGGTGGGCAGGTGTATGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062987261 Original CRISPR AGGTGGGCAGGTGTATGTCC CGG Intergenic
No off target data available for this crispr