ID: 1062987269

View in Genome Browser
Species Human (GRCh38)
Location 10:1780325-1780347
Sequence GGAGGCTCCGAACAGCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062987264_1062987269 -2 Left 1062987264 10:1780304-1780326 CCGGAAGACATGGAATCCAGAGG No data
Right 1062987269 10:1780325-1780347 GGAGGCTCCGAACAGCCAGGTGG No data
1062987263_1062987269 -1 Left 1062987263 10:1780303-1780325 CCCGGAAGACATGGAATCCAGAG No data
Right 1062987269 10:1780325-1780347 GGAGGCTCCGAACAGCCAGGTGG No data
1062987260_1062987269 27 Left 1062987260 10:1780275-1780297 CCGAACAGTCAGGTGGGCAGGTG No data
Right 1062987269 10:1780325-1780347 GGAGGCTCCGAACAGCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062987269 Original CRISPR GGAGGCTCCGAACAGCCAGG TGG Intergenic
No off target data available for this crispr