ID: 1062987272

View in Genome Browser
Species Human (GRCh38)
Location 10:1780332-1780354
Sequence CACCTGCCCACCTGGCTGTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062987272_1062987282 24 Left 1062987272 10:1780332-1780354 CCGAACAGCCAGGTGGGCAGGTG No data
Right 1062987282 10:1780379-1780401 AGAGGAGGCTCCGAACAGCCAGG No data
1062987272_1062987284 28 Left 1062987272 10:1780332-1780354 CCGAACAGCCAGGTGGGCAGGTG No data
Right 1062987284 10:1780383-1780405 GAGGCTCCGAACAGCCAGGTGGG No data
1062987272_1062987279 6 Left 1062987272 10:1780332-1780354 CCGAACAGCCAGGTGGGCAGGTG No data
Right 1062987279 10:1780361-1780383 CCGGAAGACATGGACTCCAGAGG No data
1062987272_1062987280 9 Left 1062987272 10:1780332-1780354 CCGAACAGCCAGGTGGGCAGGTG No data
Right 1062987280 10:1780364-1780386 GAAGACATGGACTCCAGAGGAGG No data
1062987272_1062987275 -4 Left 1062987272 10:1780332-1780354 CCGAACAGCCAGGTGGGCAGGTG No data
Right 1062987275 10:1780351-1780373 GGTGTATGCCCCGGAAGACATGG No data
1062987272_1062987283 27 Left 1062987272 10:1780332-1780354 CCGAACAGCCAGGTGGGCAGGTG No data
Right 1062987283 10:1780382-1780404 GGAGGCTCCGAACAGCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062987272 Original CRISPR CACCTGCCCACCTGGCTGTT CGG (reversed) Intergenic