ID: 1062987273

View in Genome Browser
Species Human (GRCh38)
Location 10:1780340-1780362
Sequence GGGGCATACACCTGCCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062987273_1062987283 19 Left 1062987273 10:1780340-1780362 CCAGGTGGGCAGGTGTATGCCCC No data
Right 1062987283 10:1780382-1780404 GGAGGCTCCGAACAGCCAGGTGG No data
1062987273_1062987284 20 Left 1062987273 10:1780340-1780362 CCAGGTGGGCAGGTGTATGCCCC No data
Right 1062987284 10:1780383-1780405 GAGGCTCCGAACAGCCAGGTGGG No data
1062987273_1062987279 -2 Left 1062987273 10:1780340-1780362 CCAGGTGGGCAGGTGTATGCCCC No data
Right 1062987279 10:1780361-1780383 CCGGAAGACATGGACTCCAGAGG No data
1062987273_1062987285 24 Left 1062987273 10:1780340-1780362 CCAGGTGGGCAGGTGTATGCCCC No data
Right 1062987285 10:1780387-1780409 CTCCGAACAGCCAGGTGGGCAGG No data
1062987273_1062987282 16 Left 1062987273 10:1780340-1780362 CCAGGTGGGCAGGTGTATGCCCC No data
Right 1062987282 10:1780379-1780401 AGAGGAGGCTCCGAACAGCCAGG No data
1062987273_1062987280 1 Left 1062987273 10:1780340-1780362 CCAGGTGGGCAGGTGTATGCCCC No data
Right 1062987280 10:1780364-1780386 GAAGACATGGACTCCAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062987273 Original CRISPR GGGGCATACACCTGCCCACC TGG (reversed) Intergenic