ID: 1062987278

View in Genome Browser
Species Human (GRCh38)
Location 10:1780361-1780383
Sequence CCTCTGGAGTCCATGTCTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062987278_1062987282 -5 Left 1062987278 10:1780361-1780383 CCGGAAGACATGGACTCCAGAGG No data
Right 1062987282 10:1780379-1780401 AGAGGAGGCTCCGAACAGCCAGG No data
1062987278_1062987283 -2 Left 1062987278 10:1780361-1780383 CCGGAAGACATGGACTCCAGAGG No data
Right 1062987283 10:1780382-1780404 GGAGGCTCCGAACAGCCAGGTGG No data
1062987278_1062987289 24 Left 1062987278 10:1780361-1780383 CCGGAAGACATGGACTCCAGAGG No data
Right 1062987289 10:1780408-1780430 GGTGTATGCCCCGGAAGACATGG No data
1062987278_1062987285 3 Left 1062987278 10:1780361-1780383 CCGGAAGACATGGACTCCAGAGG No data
Right 1062987285 10:1780387-1780409 CTCCGAACAGCCAGGTGGGCAGG No data
1062987278_1062987284 -1 Left 1062987278 10:1780361-1780383 CCGGAAGACATGGACTCCAGAGG No data
Right 1062987284 10:1780383-1780405 GAGGCTCCGAACAGCCAGGTGGG No data
1062987278_1062987288 15 Left 1062987278 10:1780361-1780383 CCGGAAGACATGGACTCCAGAGG No data
Right 1062987288 10:1780399-1780421 AGGTGGGCAGGTGTATGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062987278 Original CRISPR CCTCTGGAGTCCATGTCTTC CGG (reversed) Intergenic