ID: 1062987283

View in Genome Browser
Species Human (GRCh38)
Location 10:1780382-1780404
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062987277_1062987283 -1 Left 1062987277 10:1780360-1780382 CCCGGAAGACATGGACTCCAGAG No data
Right 1062987283 10:1780382-1780404 GGAGGCTCCGAACAGCCAGGTGG No data
1062987278_1062987283 -2 Left 1062987278 10:1780361-1780383 CCGGAAGACATGGACTCCAGAGG No data
Right 1062987283 10:1780382-1780404 GGAGGCTCCGAACAGCCAGGTGG No data
1062987276_1062987283 0 Left 1062987276 10:1780359-1780381 CCCCGGAAGACATGGACTCCAGA No data
Right 1062987283 10:1780382-1780404 GGAGGCTCCGAACAGCCAGGTGG No data
1062987273_1062987283 19 Left 1062987273 10:1780340-1780362 CCAGGTGGGCAGGTGTATGCCCC No data
Right 1062987283 10:1780382-1780404 GGAGGCTCCGAACAGCCAGGTGG No data
1062987272_1062987283 27 Left 1062987272 10:1780332-1780354 CCGAACAGCCAGGTGGGCAGGTG No data
Right 1062987283 10:1780382-1780404 GGAGGCTCCGAACAGCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062987283 Original CRISPR GGAGGCTCCGAACAGCCAGG TGG Intergenic
No off target data available for this crispr