ID: 1062987288

View in Genome Browser
Species Human (GRCh38)
Location 10:1780399-1780421
Sequence AGGTGGGCAGGTGTATGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062987276_1062987288 17 Left 1062987276 10:1780359-1780381 CCCCGGAAGACATGGACTCCAGA No data
Right 1062987288 10:1780399-1780421 AGGTGGGCAGGTGTATGCCCCGG No data
1062987281_1062987288 -1 Left 1062987281 10:1780377-1780399 CCAGAGGAGGCTCCGAACAGCCA No data
Right 1062987288 10:1780399-1780421 AGGTGGGCAGGTGTATGCCCCGG No data
1062987278_1062987288 15 Left 1062987278 10:1780361-1780383 CCGGAAGACATGGACTCCAGAGG No data
Right 1062987288 10:1780399-1780421 AGGTGGGCAGGTGTATGCCCCGG No data
1062987277_1062987288 16 Left 1062987277 10:1780360-1780382 CCCGGAAGACATGGACTCCAGAG No data
Right 1062987288 10:1780399-1780421 AGGTGGGCAGGTGTATGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062987288 Original CRISPR AGGTGGGCAGGTGTATGCCC CGG Intergenic