ID: 1062987289

View in Genome Browser
Species Human (GRCh38)
Location 10:1780408-1780430
Sequence GGTGTATGCCCCGGAAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062987277_1062987289 25 Left 1062987277 10:1780360-1780382 CCCGGAAGACATGGACTCCAGAG No data
Right 1062987289 10:1780408-1780430 GGTGTATGCCCCGGAAGACATGG No data
1062987286_1062987289 -4 Left 1062987286 10:1780389-1780411 CCGAACAGCCAGGTGGGCAGGTG No data
Right 1062987289 10:1780408-1780430 GGTGTATGCCCCGGAAGACATGG No data
1062987281_1062987289 8 Left 1062987281 10:1780377-1780399 CCAGAGGAGGCTCCGAACAGCCA No data
Right 1062987289 10:1780408-1780430 GGTGTATGCCCCGGAAGACATGG No data
1062987276_1062987289 26 Left 1062987276 10:1780359-1780381 CCCCGGAAGACATGGACTCCAGA No data
Right 1062987289 10:1780408-1780430 GGTGTATGCCCCGGAAGACATGG No data
1062987278_1062987289 24 Left 1062987278 10:1780361-1780383 CCGGAAGACATGGACTCCAGAGG No data
Right 1062987289 10:1780408-1780430 GGTGTATGCCCCGGAAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062987289 Original CRISPR GGTGTATGCCCCGGAAGACA TGG Intergenic