ID: 1062989757

View in Genome Browser
Species Human (GRCh38)
Location 10:1804442-1804464
Sequence GAAACAGAAGTGGCCCGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062989757_1062989762 1 Left 1062989757 10:1804442-1804464 CCAGGCCGGGCCACTTCTGTTTC No data
Right 1062989762 10:1804466-1804488 TTTAAAACCGCAGGCCCTCATGG No data
1062989757_1062989760 -8 Left 1062989757 10:1804442-1804464 CCAGGCCGGGCCACTTCTGTTTC No data
Right 1062989760 10:1804457-1804479 TCTGTTTCCTTTAAAACCGCAGG No data
1062989757_1062989764 8 Left 1062989757 10:1804442-1804464 CCAGGCCGGGCCACTTCTGTTTC No data
Right 1062989764 10:1804473-1804495 CCGCAGGCCCTCATGGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062989757 Original CRISPR GAAACAGAAGTGGCCCGGCC TGG (reversed) Intergenic
No off target data available for this crispr