ID: 1062991909

View in Genome Browser
Species Human (GRCh38)
Location 10:1827227-1827249
Sequence CTTCCTCCCAACATGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062991909_1062991915 3 Left 1062991909 10:1827227-1827249 CCAGCCTCCATGTTGGGAGGAAG No data
Right 1062991915 10:1827253-1827275 AGGCCATGTGTGGAGGCATCAGG No data
1062991909_1062991916 4 Left 1062991909 10:1827227-1827249 CCAGCCTCCATGTTGGGAGGAAG No data
Right 1062991916 10:1827254-1827276 GGCCATGTGTGGAGGCATCAGGG No data
1062991909_1062991913 -7 Left 1062991909 10:1827227-1827249 CCAGCCTCCATGTTGGGAGGAAG No data
Right 1062991913 10:1827243-1827265 GAGGAAGCTCAGGCCATGTGTGG No data
1062991909_1062991914 -4 Left 1062991909 10:1827227-1827249 CCAGCCTCCATGTTGGGAGGAAG No data
Right 1062991914 10:1827246-1827268 GAAGCTCAGGCCATGTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062991909 Original CRISPR CTTCCTCCCAACATGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr