ID: 1062997454

View in Genome Browser
Species Human (GRCh38)
Location 10:1880490-1880512
Sequence CTCTGGGTCTTGTTCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062997445_1062997454 15 Left 1062997445 10:1880452-1880474 CCTCTGCCAATTGACTGTGGTGG No data
Right 1062997454 10:1880490-1880512 CTCTGGGTCTTGTTCTCAGGAGG No data
1062997448_1062997454 9 Left 1062997448 10:1880458-1880480 CCAATTGACTGTGGTGGAGGCTT No data
Right 1062997454 10:1880490-1880512 CTCTGGGTCTTGTTCTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062997454 Original CRISPR CTCTGGGTCTTGTTCTCAGG AGG Intergenic
No off target data available for this crispr