ID: 1062999759

View in Genome Browser
Species Human (GRCh38)
Location 10:1905686-1905708
Sequence ACAGCTTGTGCGCCCCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062999756_1062999759 4 Left 1062999756 10:1905659-1905681 CCTCAGAGCAGCATCACTGCTTT No data
Right 1062999759 10:1905686-1905708 ACAGCTTGTGCGCCCCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062999759 Original CRISPR ACAGCTTGTGCGCCCCAGGA TGG Intergenic
No off target data available for this crispr