ID: 1062999826

View in Genome Browser
Species Human (GRCh38)
Location 10:1906054-1906076
Sequence CAGTGTGGCCCTGTACCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062999823_1062999826 -6 Left 1062999823 10:1906037-1906059 CCACGGTTAATCCAAGACAGTGT No data
Right 1062999826 10:1906054-1906076 CAGTGTGGCCCTGTACCTCCTGG No data
1062999822_1062999826 -5 Left 1062999822 10:1906036-1906058 CCCACGGTTAATCCAAGACAGTG No data
Right 1062999826 10:1906054-1906076 CAGTGTGGCCCTGTACCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062999826 Original CRISPR CAGTGTGGCCCTGTACCTCC TGG Intergenic
No off target data available for this crispr