ID: 1063000727

View in Genome Browser
Species Human (GRCh38)
Location 10:1918752-1918774
Sequence GCCCTATGGTGTTTCAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063000727_1063000730 1 Left 1063000727 10:1918752-1918774 CCTGCACTGAAACACCATAGGGC No data
Right 1063000730 10:1918776-1918798 ACTAATAATATTAATTTTGCAGG No data
1063000727_1063000731 19 Left 1063000727 10:1918752-1918774 CCTGCACTGAAACACCATAGGGC No data
Right 1063000731 10:1918794-1918816 GCAGGTCAATATTTAGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063000727 Original CRISPR GCCCTATGGTGTTTCAGTGC AGG (reversed) Intergenic
No off target data available for this crispr