ID: 1063000730

View in Genome Browser
Species Human (GRCh38)
Location 10:1918776-1918798
Sequence ACTAATAATATTAATTTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063000727_1063000730 1 Left 1063000727 10:1918752-1918774 CCTGCACTGAAACACCATAGGGC No data
Right 1063000730 10:1918776-1918798 ACTAATAATATTAATTTTGCAGG No data
1063000725_1063000730 2 Left 1063000725 10:1918751-1918773 CCCTGCACTGAAACACCATAGGG No data
Right 1063000730 10:1918776-1918798 ACTAATAATATTAATTTTGCAGG No data
1063000721_1063000730 28 Left 1063000721 10:1918725-1918747 CCCTGTACCTTTTGCATTTTTTT No data
Right 1063000730 10:1918776-1918798 ACTAATAATATTAATTTTGCAGG No data
1063000723_1063000730 21 Left 1063000723 10:1918732-1918754 CCTTTTGCATTTTTTTTTGCCCT No data
Right 1063000730 10:1918776-1918798 ACTAATAATATTAATTTTGCAGG No data
1063000722_1063000730 27 Left 1063000722 10:1918726-1918748 CCTGTACCTTTTGCATTTTTTTT No data
Right 1063000730 10:1918776-1918798 ACTAATAATATTAATTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063000730 Original CRISPR ACTAATAATATTAATTTTGC AGG Intergenic
No off target data available for this crispr