ID: 1063000731

View in Genome Browser
Species Human (GRCh38)
Location 10:1918794-1918816
Sequence GCAGGTCAATATTTAGCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063000727_1063000731 19 Left 1063000727 10:1918752-1918774 CCTGCACTGAAACACCATAGGGC No data
Right 1063000731 10:1918794-1918816 GCAGGTCAATATTTAGCCAGTGG No data
1063000725_1063000731 20 Left 1063000725 10:1918751-1918773 CCCTGCACTGAAACACCATAGGG No data
Right 1063000731 10:1918794-1918816 GCAGGTCAATATTTAGCCAGTGG No data
1063000729_1063000731 -3 Left 1063000729 10:1918774-1918796 CCACTAATAATATTAATTTTGCA No data
Right 1063000731 10:1918794-1918816 GCAGGTCAATATTTAGCCAGTGG No data
1063000728_1063000731 5 Left 1063000728 10:1918766-1918788 CCATAGGGCCACTAATAATATTA No data
Right 1063000731 10:1918794-1918816 GCAGGTCAATATTTAGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063000731 Original CRISPR GCAGGTCAATATTTAGCCAG TGG Intergenic
No off target data available for this crispr