ID: 1063001646

View in Genome Browser
Species Human (GRCh38)
Location 10:1929808-1929830
Sequence CTTCACACGTAGAGTGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063001637_1063001646 22 Left 1063001637 10:1929763-1929785 CCAGAGGTTGGGCTAAAGAGGGT No data
Right 1063001646 10:1929808-1929830 CTTCACACGTAGAGTGGGGATGG No data
1063001639_1063001646 -9 Left 1063001639 10:1929794-1929816 CCCCACAAGACTTCCTTCACACG No data
Right 1063001646 10:1929808-1929830 CTTCACACGTAGAGTGGGGATGG No data
1063001640_1063001646 -10 Left 1063001640 10:1929795-1929817 CCCACAAGACTTCCTTCACACGT No data
Right 1063001646 10:1929808-1929830 CTTCACACGTAGAGTGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063001646 Original CRISPR CTTCACACGTAGAGTGGGGA TGG Intergenic
No off target data available for this crispr