ID: 1063003545

View in Genome Browser
Species Human (GRCh38)
Location 10:1946657-1946679
Sequence CTCACAGTGAATACTGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063003537_1063003545 23 Left 1063003537 10:1946611-1946633 CCAAACTGACGTCCGTGGATCTC No data
Right 1063003545 10:1946657-1946679 CTCACAGTGAATACTGGCTTTGG No data
1063003539_1063003545 11 Left 1063003539 10:1946623-1946645 CCGTGGATCTCCAGCCTGGACTG No data
Right 1063003545 10:1946657-1946679 CTCACAGTGAATACTGGCTTTGG No data
1063003541_1063003545 1 Left 1063003541 10:1946633-1946655 CCAGCCTGGACTGAGGTCCACTT No data
Right 1063003545 10:1946657-1946679 CTCACAGTGAATACTGGCTTTGG No data
1063003542_1063003545 -3 Left 1063003542 10:1946637-1946659 CCTGGACTGAGGTCCACTTACTC No data
Right 1063003545 10:1946657-1946679 CTCACAGTGAATACTGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063003545 Original CRISPR CTCACAGTGAATACTGGCTT TGG Intergenic
No off target data available for this crispr